%PDF-1.5 % 352 0 obj <> endobj xref 352 41 0000000016 00000 n 0000001711 00000 n 0000001868 00000 n 0000001912 00000 n 0000002454 00000 n 0000003020 00000 n 0000003327 00000 n 0000003364 00000 n 0000003478 00000 n 0000003590 00000 n 0000004005 00000 n 0000004543 00000 n 0000005350 00000 n 0000006018 00000 n 0000006738 00000 n 0000007486 00000 n 0000008116 00000 n 0000008705 00000 n 0000009151 00000 n 0000009267 00000 n 0000009580 00000 n 0000009933 00000 n 0000010586 00000 n 0000011249 00000 n 0000013899 00000 n 0000017527 00000 n 0000018395 00000 n 0000019232 00000 n 0000019536 00000 n 0000019886 00000 n 0000060047 00000 n 0000060086 00000 n 0000060161 00000 n 0000060497 00000 n 0000062408 00000 n 0000125126 00000 n 0000127248 00000 n 0000263596 00000 n 0000265348 00000 n 0000335370 00000 n 0000001116 00000 n trailer <]/Prev 2046107>> startxref 0 %%EOF 392 0 obj <>stream hb``Pa``Ue`e`} ĀB l , NYߠuU+I> ^$ R " NzhSKnzvu1smpYQզM ۵tvLXf(aZ|ZTdYMfIXL7elv.k#8 6n51Q& hG+q|x:]Hl1OPX|li0w@@^с"((`ǯ⳥u4`)P ̡ l*0*X,a /2hP/ZtaR[ ?+LEL x0+08T􁁉AhǗLRgX0M}@HO]=#_0V0j`-`Y IFE `+D 0JK@N @ ` [ endstream endobj 353 0 obj <>>> endobj 354 0 obj <> endobj 355 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/Properties<>/XObject<>>>/Rotate 0/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 356 0 obj <> endobj 357 0 obj <> endobj 358 0 obj [/ICCBased 375 0 R] endobj 359 0 obj <> endobj 360 0 obj <> endobj 361 0 obj <> endobj 362 0 obj <>stream H\j0l/G3jڤ\pl%54Q)]XC: vɕ?}r Fw>u};}6o)w8u_2囻{C/O'wgw:nv]+|E2_W+{Ws sPA9sPA90@@@@@@@gֵh}{َgOK. > endstream endobj 363 0 obj <>stream HTKo1W196d+@*-B}>{wT"+ŞxǎSuĀ N͎W#-jqi}:FCCFjv5tSóSbb7*0|]بgM``s1(,I'Gu֢T Ѫ=ST @ rIH\JZ [ЖbFG^ЀTmKl)Ăw꘏lG;5K}UAiOݚ>;s!N4u[u9Y|ZCfAo^/(,J|zcL`|`ZYp/&ćiҰ# DpiÀ^=UΗ鵚XWs[,6\V/'i/gUn>?WkָHPV1LnЌ1=0jEY3yNG_/t esv'gHIv *߈ C Y1ƂE͖u ) Ɛ 0?1 endstream endobj 364 0 obj <>stream H=0sBh 1 ڠ''O3&.>HZ$zͩQ1IpbEè, 6K_6|!K|%b+2S im#iQ-MQT<#E6 C(?7 ߂růG']tHPt/dF·8ᬷ`ǖB ȗV y'ڮPj#(YVs}˸|H# DÂOZ/Ԃ{cM _|zQOd1|qNIβTZ[4J !C[)qr?7jI+Q )>EcuM3eH.d-)QBY#DAsL ܷ L8L_qD fzM}f' I4tZ; c7vrW@5E>YurPv_%ԡ͛ r1&rk~ip1x!W&G-tB"v!g iym&1YbeC[ųeY ѯBKk??&# endstream endobj 365 0 obj <>stream HdT;0 } _`5HJ1rɤWMIc  3ZDXs<ѶuH9ћ,97uj Xmzf.;u\y6o ya8w _EHotZ§S-~rCihgQfČ|6dgl6 ufpW p<= n2d"/pX& (4e3>stream H\M! u .0 (H_{:ZcgZm"ޤZuW;8i \Ah{ 1vo{//t[È:f$ '"܅E80$#0ʜEj AP Ŝh41BC鈒4צaIf@bz"V{C3xyƒ<Ig$Y Gf[~ϙgBXlW6eI㦫OpgKHٳ]a \-q'u3!WI!m=8~_RçuKBKLu o8’.Z{GvՐAv("\g֍('rmǿZ` )FU(1Oo\mV'|u@P{0o׵s(^# endstream endobj 367 0 obj <>stream HTIn1 @+99,R4X#,dQs"%)KMc@)Kֶkeȉ۾ၰ<+L¹EJJGYʼ nJ1  - tp UZH7$m-CN8MJEbK eSVY!\FMun96A <Ï%HEQP(KE9`' pBbTt9%Dđ3{,0B*SM=W@$4[|وd>}ϗ+,QG^'*|C|mq~8ʢ~t`rx; koPn sL[F{Mɕ"rM#}Q0M7$4xȮS<ם']l+B0DutOmV<Zi `] +eó)@P4c_ !t}aicMWSwh[]6%RvNK>stream HI0 E>.(QԢiR'B#@gsHJ1p7Jnq?B _z':t^G~>nG^'@&| 4itjԓ כ4E1 i ZEhE/m6:/$Ӷ{EiB;?y&!>*:'3*~n?Q"ec3L125]s_D 8_ \˿bH`ۥ'0tsCi^',Jd: (z]!ZdkHA?5Ejԫ].{l3TG1%̹(/sm]N1ig,۸A+b;Yj Áb!Ҍes_FG'ݗ6#@FeϷ7fӆltqv05E5\Y*}z-BO\_L^å`䲼|OgZ# endstream endobj 369 0 obj <> endobj 370 0 obj <> endobj 371 0 obj <> endobj 372 0 obj <>stream H\j!}L.sY()nM+ط! '38S:Iwa[Zjx?Ug2G[7LL)cX`d  uWX}5"T4`p ޿#ϲMk(n!_D>ץ=}1LU4Pg Cg2>0%RrUv6bYX&%>>$>,>2HQX$.2y}=H,j!rjRUxBB6[R~P endstream endobj 373 0 obj <>stream HdTK#! )@(csTEb@w',b5?H(^s )~)X֨%P,Z ߃'#E F$fB4ќZNQh7ShuWTNKņGM]ŦTk;2]" B ه6]@0oIvёNP*C[2+9 8ŕɂt\h2NVC.4$ߊ5z ^6;yRsE@$f@QM%7ڳئ&ɵz>Mǂ LZQO$YOڵ. DhyӳT_T}k!t&inq5w}EJ!x=o_?# endstream endobj 374 0 obj <>stream HSj@ }W}F3 , M>4M y)`@^~~nh XGGKkM-lb4>x|*&xuAo00FwY)Z85$A=7= ǭ| =͆=A`:tbCٍH1܀⣜֛d C?)h3JXScr2:x)0hF.";w`vUiĘ]mMJy}N>v0E:GPf(P"O 7Q)I=93a%b8mX,g,@Q(ɳղe/?ۓ wodo|oKFW,A̤r rr=^YcΡY]?k s5< k8^=XO༑ƨsQ6Q]{~}2cxNƓ eb'ȱKl5 U+LX-śͶܬ7Bj'o >Wr}:Ϗr]lHz.D/Es}"gK  endstream endobj 375 0 obj <>stream HyTSwoɞc [5laQIBHADED2mtFOE.c}08׎8GNg9w߽'0 ֠Jb  2y.-;!KZ ^i"L0- @8(r;q7Ly&Qq4j|9 V)gB0iW8#8wթ8_٥ʨQQj@&A)/g>'Kt;\ ӥ$պFZUn(4T%)뫔0C&Zi8bxEB;Pӓ̹A om?W= x-[0}y)7ta>jT7@tܛ`q2ʀ&6ZLĄ?_yxg)˔zçLU*uSkSeO4?׸c. R ߁-25 S>ӣVd`rn~Y&+`;A4 A9=-tl`;~p Gp| [`L`< "A YA+Cb(R,*T2B- ꇆnQt}MA0alSx k&^>0|>_',G!"F$H:R!zFQd?r 9\A&G rQ hE]a4zBgE#H *B=0HIpp0MxJ$D1D, VĭKĻYdE"EI2EBGt4MzNr!YK ?%_&#(0J:EAiQ(()ӔWT6U@P+!~mD eԴ!hӦh/']B/ҏӿ?a0nhF!X8܌kc&5S6lIa2cKMA!E#ƒdV(kel }}Cq9 N')].uJr  wG xR^[oƜchg`>b$*~ :Eb~,m,-ݖ,Y¬*6X[ݱF=3뭷Y~dó ti zf6~`{v.Ng#{}}jc1X6fm;'_9 r:8q:˜O:ϸ8uJqnv=MmR 4 n3ܣkGݯz=[==<=GTB(/S,]6*-W:#7*e^YDY}UjAyT`#D="b{ų+ʯ:!kJ4Gmt}uC%K7YVfFY .=b?SƕƩȺy چ k5%4m7lqlioZlG+Zz͹mzy]?uuw|"űNwW&e֥ﺱ*|j5kyݭǯg^ykEklD_p߶7Dmo꿻1ml{Mś nLl<9O[$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)Km endstream endobj 376 0 obj <>stream HjH50dk\cg&f"΄G< Oi"ԁfN஡鄹P{ Z`?Ʈ:NvZnXصt+UX_ X"`2CD_pjȒe]MjR{.8y.JH)E:{rnۥjw(}l[l֞rEBmxz^SŲbZQppD^]>0 õPO#O=Fp>w@ QC?2x~9w) Af~XƏ,kZe i-SQ)u h-<ULPZ){2UCwC sWZζI0޽[ $cЌ޷&Ǡ(k5I6ۻ_^nUgr".n( 33O X&_B]q[yf$;W!a8D':sA`+HuS|юoT8#Am,>V4&M7YT5&i~DnUh9} >K=lp ER1NpdbMAx}"Uv9<~[~?" pUl7Vn|xhh׮^d)R:wފnZ0=ĥCi=yo@ ~LPxTdF4 `Z95eyJ}2i)f3 A!cn2>ck@3p羲\"b1S͎L#zsc{xܦ Li*ȁV*62gcȄrە{Du!%F` b$]jK*k'?Si)աAL؂MЂ&L<Gl%3QCsHJbǼD]AҌ8<Ww`"!HTG R`׃su{n"D?4@=JxAĻL19Z &dG:j ya2Ȅ[ )(y"_nޛz< "]LZ7!*C@VȨF-@0缤 Z\=W>_{L'.8 S퀹D+dw -c=L|qgC}'*y=hx󁙡G,cÒȕ- Uc;h!c(CȔv0͗vsS\|?M>} Wq7n^4GE6/,A9͎dK?T:+Dle !"©De>u+D92PGkR )@)#6A*^ 9 ?lp "|$0 +d"v9NGXp A}3,gia Y_m?i?ȰO(ҌȬBtXgښ-.uk;M7}Z'`CNEw=ycz*2+KLי^a`i6j 7(PW=B~V L;Ǭ Tn *[}C{m8 @60j1]%0Q\a8gfC뎙- E"ڦV PjWr*hR VAE][?iAӘ})\ ;+)Ht^k_d;LRrhqrˊzY;bPF|ec%lܚyHΘ]b{NpSIE.c`4y'LS7`O!^FAnI!i$A{s\3_'4#Z oV()ۺ $^4-*k,_w r048.,P;6 FYej٫u;/m9t {wڗe:3 pr40>LNTX_/5no|\f3JlQ3}:DG\&e%&ft]y\ڝ2oɢJ+TXiaemX[GP1O:r+`eh)UVYC^[k}̝v`ed]SWEDkk%_9=RֆP9xL't ԏdࢷf%gN4ݘIMw\y4)ɲ$61)&!QKCt0f^18{8| Lhb@`Q5ȑs{v`cy+lBfci^ [.r%o\ \70~^˞i`9P[8NjVLHII ͌瀑%u_ٟ,YKÂ$4s|=*euv1H;>pG=@eS$(iKJTX2XqPS|BY(ѸN.0)pNٳ.hG侂35Sǂ2< M􇚷4Z֤fnF&}eR˫HR'ٙ7,gg50ez5>5pXB;#˲+U6xFGۚ(K=ulT\"v  8)ȍkR )fv/MOt18##7]E 1 tg3\3p)zw@L{(kCT,M &19Yj+eX-d*nڵ0+Ђ ^ "CiL+)$ t&)oN^:O8QwHo<(iÏ꣭%>hqlrBlJ^4ZceTI3AX iMAtq388@P endstream endobj 377 0 obj <>stream H$]LU-̌nǏ8vv[-t_kZ VkIX5%,ЦMfn\ilk}115QCw9I=ssO.g|Kk[-/7{ѶSu+v*.~*)M )ۙչo8?Є?7bm9nd:9:8zQϪ$7221Vn>stream H,Pkl aNw6j ]fj铰ڊDmh)C7j4K c#A ?CQf؝ B![w'9J阊%W/U[U@S 59)&8d$xwc6=*F#@겆mmF`svuЭnhS5=T+uW_Uj荺ѬբU+6XmT&B(/EBr #!?')D $D0h/)ْ舳qz_`{X^n}`ݵq-]wo٢e/fy1%t FF-48,-X(%Z }c Nhg@DI4B n.!ry(uSG-xͷHFD|"6/d>$#߆Ų|/}苢G >œrK d{87eEj7Csjc ;({(Oֺ A'ݭGǁxa߷LO%9 a7.dLX+ñP;ʳoK#hwSW` Y`̂ >7*wpU0 @%HUk. Đ$8o2KDG))0TaYɩv,{ *C:,V]G kNf}z08 Q#v& endstream endobj 379 0 obj <> endobj 380 0 obj <>stream H\j0 ~ Cq% =@j+aq~B˲̛5wàr̫wayJKGqSo'q- 3%68\|#oNfWw?8A] xZEyiN|nq]oFd"#AjF>1QYF)29*qI&%KEUD&GjVfU&.B{7]*>stream application/postscript Symons Logo - 4c PMS 7599C Callahan, Mary 2018-03-01T10:38:01-06:00 2018-03-01T10:38:01-06:00 2018-03-01T10:38:01-06:00 Adobe Illustrator CC 22.0 (Windows) xmp.iid:f492040d-2307-d340-b216-99c1e5226788 xmp.did:f492040d-2307-d340-b216-99c1e5226788 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:7d1a98d0-d99f-4574-b2d1-fb3306cb2800 xmp.did:226a81ed-b160-5d4c-8138-e278c1e9e21b uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ca36cffd-86fc-4849-8205-31f9c3f7515c 2015-05-15T16:46:48-04:00 Adobe Illustrator CC 2014 (Macintosh) / converted from application/postscript to application/vnd.adobe.illustrator converted from application/postscript to application/vnd.adobe.illustrator saved xmp.iid:3068801e-d168-284f-9163-604bf941bda4 2015-08-04T14:58:46-05:00 Adobe Illustrator CC 2014 (Windows) / converted from application/postscript to application/vnd.adobe.illustrator saved xmp.iid:b4b74721-4bfd-c444-aef9-4060fa7df372 2015-10-06T09:04:51-05:00 Adobe Illustrator CC 2014 (Windows) / saved xmp.iid:05296eeb-c0bf-f540-8ed3-444207b0c0cf 2016-04-15T14:37-05:00 Adobe Illustrator CC 2015 (Windows) / converted from application/postscript to application/vnd.adobe.illustrator saved xmp.iid:6fe23aad-e0da-2046-91df-e4743c01eb9d 2017-12-05T15:55:35-06:00 Adobe Illustrator CC 22.0 (Windows) / converted from application/postscript to application/vnd.adobe.illustrator converted from application/postscript to application/vnd.adobe.illustrator saved xmp.iid:226a81ed-b160-5d4c-8138-e278c1e9e21b 2017-12-19T11:17:34-06:00 Adobe Illustrator CC 22.0 (Windows) / saved xmp.iid:f492040d-2307-d340-b216-99c1e5226788 2018-03-01T10:38:01-06:00 Adobe Illustrator CC 22.0 (Windows) / Print False False 1 6.550781 1.757813 Inches Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 7599 C PROCESS 100.000000 CMYK 20.000000 89.999998 100.000000 10.000000 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 endstream endobj 382 0 obj <> endobj 383 0 obj <> endobj 384 0 obj <>/ExtGState<>>>/Subtype/Form>>stream HL1 0 =x06uvpPPM?P*'zeZ G?Y}e:q2Ԩ qfcSI; 0r} endstream endobj 385 0 obj <>stream endstream endobj 386 0 obj <>stream Adobed'##+++ #-%'4/%-7/22B2/7:BBBBB:DDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD6 V"  {!1AQ"aq2BR#br$Ss %&'()*3456789:CDEFGHIJTUVWXYZcdefghijtuvwxyz?U1!2"AQa #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz ?Ҋ f f ``` fffff `! f `` fff@b ff(``)(`aXa,f `gҊY f ! `  ffffffff !ff ``` f ``(@``)f ``) ffff !(`f bA``gH(b(bb ff !X(@b f(f ``)(b bXA@@ 00P3 Q@0C@H af(``` b  `b fa(`(```` ff X(````C XffffH fa(fffffff  ffa-b f(`` ff(@ bf b ff)@)-3 P3 S1R"4-Eߑ`A^J)Uh㋺{(bf cE3Ҁ Y ````)ffff !c1uh `3(( fff) fff f(bf4 P0IIA97dXR 41۵&ˈ̣ԓAQ:\uU=Kϯ^GyOv'f_z'ܧ?y~R~r ,X{n:ǟS.I,f (X@ d`b00P 1[@bf bf `````) f( f b f( ff c@Q @BzI?_*n꨽en_k %߀LN:/˭F,ܽƖyˤ'I{jˤ_}/zFnD\?s=Zu{\oYrenPvI7f{c9qRyBRiӨ1Q@@XT@``b```((a ` f XQ P00@S0A@$@@ [bXF``(f(` 4uc':)k8ʬmx__lã/ʷqeR7.?lFBzt32g=>:4p%eHǾ=3ͫHS/q[!q<;Tǣc }ԫ1'eo:_Wc"㸗ZxnW'.x_cŷޟէtm]q^KE+OD03S3T@`` `( aff(``f(( b `0@31P3P0@0000X[W􏬩~Sp\~iSRUhqjM3YCpX/>9}j|AF9pO:?qbp2̏ڸxo8U>qG_.|<_%\C2ׇ} #]9}{QU:/W \JxʫOSjNTQiɻ, \="j(%yNsItԫNRnJag(F28*x+}ktGQJRk Gk a6ˆ6y7r57*pcږمR*vxrq]O YF 6Yk#>ɻ _._VdC KfQtI}(*m+ A!5Q)'tRf b3ӀT ff  ``f `@ !ff f(3 c1Ƌ`,K0cE3 3 13<~5}^K r5}OK{ƀ9.'&K?x_khkٯF܄<3r :S̷/=,,ot:tܝf& ԯ+V<<_r&YT crU.Iv ))>&>1Wc+Ej'* M^ھ ݻEC%#bHsVfc^B+-GiK\m_0FV CEIr|iwYA˷8RGx}i{q9X fӊU0``( f `(bf((,)( b f `)(X@€ ,()(`````````ߕU_Ytla~ӛ/tUB HwFX=ӕ@\qe,sId61QJ+0VQVYIK NQ~Fow͏QTwvwcVmOM@߬wԥ^qQerXtf1_ Y=dH)FsIFrz*~@f1߉)Lt$` !  S a ` fa(X300  a,ff(bX00@,```b f b ff b f  ``A qFkȧ?:I|uV 凴ܞ"Ņ'?I;w $y''ttk%y [7ݙwI!v,\m!gfcp(n;;j B"gdMwǩv?دNKwgZS1­>+rLffԀD fff(@`( f`0@bf(( f bf `XX ~5^EX"OYA_D7KWI';i}NX{.a%k rF`7=_`dR]bJkb-2^5vJI<|~ᗇ}fF9<\9wV{4-bS]=˼4kJP滵3)E?55FRRZe硫ZP03Ԋe0AL 00A@ P0A@ P0A@ S1P33L@@   %0#M}V%323jk jMlC7?/$w䉨JOd6iXo}Mz;}`{z>r,XoKf7OEi+d6QQ0!3 -owJÔa+0k~lre~b`t~pI8zIq9g̕Ja4%_8qԝ֛]曂xA28 P 3P033@ P000L$D3@  P00l300Q Q Q33=} ,O322XExͭDU g&^BB9+ keԽnwwm(dk⽌s\{|bcer3?րa``bf(a( f ``` (`@  fff()f( 3+Gi/Ȯ'jOW'nIuk/[O-T KIqbhcZl%ٿBsy rC.IJJTg&Bu7Wr}ɘPhV;g*tx஻ˀ51j-n) J!f@MT_To̳8{FT 8Zhv^GJ8N͏QVHkIs_v2Rrn1weio9-ܓ lSZ6j7[$`ߤf5/-e*Jk{Jr%ᘶ>v4ac[~ I|8,gwU4?]ֱkU]4k@t|UvX3MB3odMjsZJj'F  `g qrS0@3 33DS00@3 S000000001b`@f 3HNTv^qj8Xx񼝜^/C3VJu%J~=JgGVۧCU5;*Z_|KG_픾%fQQ)sO'EQ_z[QtxRYH̗YnLQHx|'f=1@@3@3@@033!no+"ڭ$s+œO`y wӟmG*y{f+mdM1ػu}\lm5e&c!-Ĝu؊*k7"$܁< V3Nf`BE w--atȏg7R{LTwDVVw1Э oo1R~Mq&}jYqT5$טcP`(@`gրf(@b ! (f( `((b) b@fFWns!Jk_fy|o&2i,-[3y|(}q$!g/)3EOTtOVޏȗ(wDU)??om/s.J"*Σ=0000039ґZR{?QQIwyGeĵҰuk}o/q^u2J': Dm$U5e8IMq$@a-3!sm*ea',9j3MI |JV~ a%%1JZE3 W#3,j~B:r+،Ŝ$Q'O:(bof iJJI5cc4[Kffm'|ʦ@C03ր@`(`(@ b f)a(`(f(`aq 30 C0Df3D5B{k9K[㓿殓&ˈn,Y *F}Uz QWN7ɻmZztש$-X/~zK)t WnM6gzCOWЩxI2`0Q ffx+judT.mf͋* SVO-T 9aI~!Q▋E#|Rw~ĉ)nl ~{drm+?b3U\i۹1!zf"JJ[ %f.fb_[p^&c r0A'S]r&W⟭/9E@x{8Ku0KE'*P 9b()b %P3331@ 333@ Q3@9Ɯ\쒻fd|WMEyUi9zg%wųZUd 28Stb`]h4TDU"&9Qұ5NÚF>#)ԪzJ.Tca@#j"=Wm9Q,\֍b:-Wh'o6ӺtF㦫ɵJY95l68E%$I =RS6Q C1Df(t>y ]wz},xV.sIwCib3 AD0 3gY%-F"ΟUxzSZ:p#*rQWt*=(}@ C03锱A>z7OKH%%OX!K5)g/b"QEYE,{$v*VyG g6o-gY_$1WvY;f7W~qPIrc(':K7?"n&T䵳z nAQĞ"u9d6AhZeulmOCX=ұ4Itgg|$#H`B~(ZP34O$tnW !bԫ$[Iv:gFUZ3N:G4))%uv" NwqiI{׀PD3 3<I*mJYEjN\xy:$D1zYG1LWhd¨(.dhv]fdsgY우u rW6?`ik&r~B^y_2UddFc1jDȣQsK}r~ ydf:vPUn#0df^iۜ=Dzx}tN#)ΠgՊ !D33D1@AL3 001@A@  Q QQ Q ̟/~#O[*mOĤj((#p30ݳMF)GYB{\I9he媘#)VWwJ]#X,Ik'JbOn ƒk-)< HE4tiz/^dY6#a\吝Tr37no1qKEan.Or5>K̒$HK|;5tdf wzifeհl=b2{x:'gՀL `(b ``!ffffff6#Q6Ԍ('-Z`((ߢN2\75eUWrgCz[x[NpFMl.bNcQүx*)Ԇm.uY1nv/"m s'LUI=h^#I-יS6. 4e-^<ט^en隚rIeQ$TFnDJ h,\R#j+%+d0JsGJ*=9-8{shқRiz]TU}/ 1%f P3,)(gLC)Io bXaM[!No9g=媘dcg=dl9+s{j:X䍌]ZQԖI<1dX=SsXKOX7"lkiI[fcKWl롢hbMy餲 ua!ty?&AczAAgں#N_32iZI)]ef'U:NͷFeՠӺoh ^YvujJayj`f ffaFb `(f(bf(bf(bffap;O?/&^D¾hS毒%>{M!1TJrOW5&Fr*`ai-M9-ZQ"*qDmЕr$WJT 8'RO&`Q[4tΌB*~ȣBI)4Λt.cWlSs](bzQ}M>Ry];A-+û_y|t2RmE]]=8F9.lt ي@1weY*roŽBu:NHl))m&ce)V]XF1l_fef+9,l N97yx6i$HZ.ߐ)`V gd͋K/R#u4.7- :z1`ޭ5IfC[&GQ5bg4֣*J뙘JFu=*s3Fffxfa2Ԡ1@)D``fbf-ĸP 333 Q3PP0$._57b]׭:YF^FÊxh|4d5`KC93Re4WZ Oſ$hWn~m:u3Vn5wȟXxz_|jʷKY2nF.+Q՛Er5/'ҧ2(@ -lݢs30}5ˇZ[NR~JxpB*t7Sܟ9.:pwR[w"rh ciI6G(eRZm'ݻ"maJ:'Zbq"<zU\MH{LY1O>T$-b1|&j/TgW%oyT(j2DǸJR&jBJN["7Y!z2I"A7u ĆXI6[ɣ]HiҌV\g=' (pW x.:OS>L:f zV8Y>VWYJFފH!*MB:r^ͦ;ḱ|I}L5cq-cS)+T~U:1n=sS׏B"Vd \ L ``Jffffff(`!f(@Aq1i}˽HÀM:i+?ӓ[&/Hxҩ7R1rަU8k(+d󎇦*Ԅ(ҋZ;歳3r,|[C貌)ƛF\E qŒuIII'T)":MBl;YT_9=uSg)-؏w! 09d8O.2%9}ô]]eUx5QyqU(uKN*w-Ks xQkҍ:u9N߽"jYY]'NV'J Mx9]\/kͿZž"rKQz73 @ΈIOsQ {YWǮ.{2 na:^Xq׬?*NoͿF+ MQ#0}d)9$w~GGuEt5gQ6\HxK<@000Q }%n?=ΔԏK6O=TB(SxMmyz?D"g+Ir^,RI[#1)PK9sIWE.o'K-b~"rz}ѥ^yT.q )~Lf76bb C}-ȱ?J\*<ȣR+{x=Kqgv|ј&?N"nKsU_}pG>TRfL ```(fff ```* `(H)4'evކ/;PdD='ShKݝi#ƧQFp_*Vl.RMm&,uq" }y6Y'Z&Lna>%?%M0n%eQJO;6Wnݚ{eBӔm- *+cU/4'UWpbM$>o<=N]S҂W1saYӧ+F7.}iN1t֔8rJ|%o=◫#; e_XM&`ANȍNƜ!tfEiPq#' $C֌1H:CRӅ56۽Wo.g:M~GGiu?&)<$,RY]ǧ|aV ٚN 'FT%|MHtd8/5y&iܔYMi*jm:do>\yVVy[aO=ISᛎ,䯅6#U[Vr:C%+4œsq+P_TRr䭢<;,. 7tZ}Ҵ=^>+J?ђt7л%QpO_Q]V̒4;8Af AHsOcɋtPӰcɍsը~$PAΤ,]*T>f ,$g Z׾w{JvQKL~jV:GrMҊ\ҷvӤb<Ɇa ` XJmfvo ,EӇZӒ}&gR4OoWH6NCC^Bn`$mqb)bJ1/,)gcwy&fv~L|`~5ӊcCd3N kǨAlAU7Ck™k>R 8/&,\SN.{SZGIgM'%n KL ԀD`(@ f( f`(``( iN,'KB^xl%wv>KԌ)&nՒNޤ-sj.l༖u[&5c )Ҹo(buHWޱ&OM!_Tu0.T+tkEJ1!ºKitJm-.y$o?*\_nf*2Rpq&]o1G=vMCTZ!+eNld:u/ ƮY&})\GI%r~$ԨGJU6&iQS,"^e>VxݵVܩ:v#u$eS48gUʝC'a8'qaNl$ը| ѯV:$Lܯ^WnjQU/+]V ޏp8pz/bhH@!Xf ʾroGWЗ_(ݧ\ؙ*]<:yb/P%$'1 uvս#NU=7d_Hz+_v6+sfIYh)kĵFb'i< 7M}pyz`#ps+W-}Ķq{f5B;fWuP{yݡNRi6ls_uiaWrh'7e8_fzNvI7Թ@*@@3?ԀD)(( `b@uoqjfis;g8B+%)+ݧ'!JU$46a=^15vi;-2."^ $D|UU=3YS$.հ͓u FQݖW'VE: *j< BQ]&pQp)qN5dv}8kѽ3zg9%o+jt.mTo;2cz= 9/fbqԧ{y.I-ڍOK4BƲIJ 'xR)Jl1J\ҥN Jɴc*VJZDdwdV-1:I9؊9!Lr&ël `VIj5F*[w Hp1A_)EC CgBOcf#Ԏ~(ZtV,:פ3%AJI% ;i_o"8jQK('9eCtEGS&"#=L \f(bTe3 ~ 9Bf|de]GT],My-*Z$UoٸOK6ދC1~Ņ5x^D,=}@c؎Rq[pn n7-~O1w{1rK+^m30yoaQ ~aE)yeD-N)pZ4׭XFɴ)*YkGWE7 PwY%"Q,FbκeNdʘjPu9OvY[LLN:.f&)|'_sn4\Ozy,iLII,5cRtaɴITӄNi).|q2ѦE3? Q0`f((ff `` `P +q )%t*bvr⹶}Jוq5*j+_>ⓏUMWz߽+UUK5};r+ƊĮ#p DrXи*R>fMtRkĚו_zduZ1>Sq&W SȻ.#UN~I.mQkے:'Gp>mܒe ztۻVV旼 ;:YۄEk⇝Ԋk+5֟Y;-9֒wѦw Js$9FٲyIKd{(I3IcUYVsvEZ#IG}}4od_*>Xӱ4'mae'^Jc0'JrH|6*ʕsӋi\&g+j1߄sV5Q=jE} J6me_SHZO#o;ja@3L$@C4O6brro>lg5b*71جDbmG7,ܒ$I,# ܲ_r;$z5lnk9e˙1R^d/V#1MB݇Vmޮ)l'Vgwd{6f"ʐ_1ofd3Ww{dڶZ/SY]e32n=҉USɕڗ$vӎ jL(D ffaf()fff(al`L  Q &n)qu|-rFzk.uEEQplfW}wpXoF {w]2N+ğ""tO B+6K70ħuDPqu-j_i|GbË́#Te3a/"P:X[v2HFNlCGӬՒ?&iھ|YxqK*u|!n_t&: ZwWiZ2wvkWgy=4[!%w{2u"kZ'|QKJ}7ܑb ھIvE[kbK>#ACyFe.Oyrz9tiţ_t}+bU/Ͳ1G$s 5-YqyjkTR;ppB*HkUXihK:d tV:iwWKm;2JyD-Ft[q]FI4LČE: eJ-8t֖c8Eq/c be)σ$ b ff!u23',ymf|㔽~^6ߐY&I ,JJ+둷)+9:4xnzfĕDOe0%|U,.v۾y!,FdX)?WbzG͢[f &cpϒ>jP3#9״UN}۱/m c<:-vb$_ ,E(ٺ{GTNI5iѦZdJgԊ Lf) Jb f b()bf(`ݕ+dROK\=9ͣ37N-^ ѣV+$HJhDxG^\E1뉶J$*aIXbOBhƩANh|%N_jǶqB]0E!ר*u)-9_G\Jfhl('+=ޟtt25oHT<)"#nz-33}')ڻ) 1frK cK&E>V!AEҚGÛ G?QLQ-8 00@31D39Oy3Fg8!=&T{>NDgSM߹d.Lƕ۷%m_$1X9&QQIJm(綞fcN1o=F>dkZ'噀v0Xoai3맒Oɉ׮N tf"+2c[fE*kGLtjگ1g$"JI]\,E97v+sKɅ7d햊)Y' pRRqD~ތ{ԀD f(`(Xf(` Xe.>ZCJeznߡ6z/Q%ih̟~UwVݟh8ƚMzJBWIm}SQ'%k.Ex^L4.$g;IvLOPv~/?i}y鴡M8iIК8bʬk5J{* (JPߴD 5ᣵjj_jۙS˼9MJy==+,%z w/聨,Zx&4\xbpY4wQ:\'O=~*ury%Ew&̯q ӛB.YREG?( "9$1]C2uLmǼ8Ap g_&O6pO>$lj}E}1[NUqnQQcsuD K6.X5Wqyz΋ѕ#W(gj)R]Zk:/GUh)<$&P P >n=r?sj;{yJ.RU吪~mEnCz8SPVLl 9ou\R}ib4V\LCoHbuI1#UUkGR4&fΞD1gW:otkbyE*0[$tM)EkFs(s^g]-WqJVva%¹|ISNZ'Qݻ+TB8pՕݓ%Vo"WOWP4Q+uL8^AgVƸXjư7Ň#gw_XF*M6O"҅xXppf(9)E=%.M5Aeܒ9(FRĖ=yz2 AEYuPysjk` @ C m֞'hkj=9Ւo[X\6YZ*Yi j#E J/}"gI*f>IGL:o31iSsy[Ȏ ug}rQ7'+a}%ޭ/h&{GKOՐuݷA.$iGiTиvtM;r_<*Z6\tJuԀ Q0b `((`p3@\Ps1@K FSm-َn"qwTs7OүRzRʍ5y3VR9]h%0$Vc~Ԓrz8ݶyzp I9j_\8QqegFdʊ5E8Zzt,2m6M?'/Q!MTC&[W;h1D=Mن0VU%ޗf: X|/rd j|eY_<>J:TkM+-gxD}Jq+sep☇JN2YF|<-J%drpѡt` mr(bi+Ĺ2:mKf=Ibש1cR-ks}òy5uz=+^)ԓO'6ɞ\tJu0?Ԋ Lff(q[ffff `````bq.! 1m15y1}=*R:8'Ii"塰/ J}n&umz:ؖ'lN֍XԌ]>_5BdZ4.G 7G$N"Q'䲆+w$`È^gHe|:F Utmls 97EF:D8MJfj)ԴF>ݥG(,ǡ0☇œdAQ꩸՞E+6ogڼ{rrwn읭*Ӆ8OA)En׽HSo6\LXԌGu !rUL-'}1鏴Cq}1hZ{G(pNxjU<)!r% X|;`!IZ*gٚ"hN:Ɏ\D'57Ox_r>4*u07~]0\Ok;u.ע|z͑Swj䖞y28f~*:}UOi%vuN~>{6Z6S)IԮ]ʤ=LlEFcC쉆Q̓Of2Ն.;XU5}cE u`dVB.K,gYC֯wzQ#^VC87,=Nj"q:u'W0/t|b=~LवM L4&ZqbT f( ````  ``bf((+콦3*ܛm]_Gzԭ$g)8wйnх9šr~;""n>mox5Q-ov9Ú51C/YhG8ѭGjn:#)bvlK;1ՎUKSj֪r,7!B.wrԶ{, CTR4^6&Cj)q1g~\W'S/Q[Mgi̯C[$yپgp|S1W_Ib%y&J.{dzOM+QRVa<"IGg DaRMK4,J\'&vo7w}6kS9_F=B s~C4F&nDt~r=U澤Xqxh-=-ew{컍Gd/qͫQNoE}~oΩˈ֑R&PyqzW*qMm`S2Wldj<:1 *HISBOfmIhhuJXEQub 7'_VÉij{iׂwRf%9?O;_0\=oN\Gi4ag%{zi/ο;?gq]S[W+|N+ M՛m|*:Bjsj7n-7R7*ӵK#έaj]^YaA뇧E]%EW#PVu]:ފ.k#,֯8mb݊N2eY-lU$ok@FXI;!ꥶ3DIHOd'bk1pXlٿĵ-5}bQ|*SSЍBpq9#H@FUkI)F:}1C"K 8=;}s[pJхbq DD#sPffҲ=3XJٿrz3QC%ƞ,VI!l۾-^&cCeRޯ5&$> 3#u/i+ɴ#|0^?ŔЎu1Y8g'X~BbW:ֆcR}]c%t| :m?4.K+u]GhL:nMw<ѥZ3Ԡ # H) fabf(bf(bf() ```dHIT{\e*w}`տ?p՞Lú\>" AM-!dLBmrΞ4ۆ (~bZ觖זQSN2WOTZw--n˿ҕG>|S?\qRQhQ}|LntmF˙g=)Ug$'epg9pUbSNѴ_nrl#rtJX/Y]g"$L" :M{ 28SHXmCՌ,Y>FaX1aԢ2k]/G *t|ˑc+S_PĆX҄\ɻ,z't14W0EյGgYGqL-p@(``` y){=J3SO x +Fr:[arCԊKFƙ[dݭM)7*akd߂dݘ+%9f@V%YͶ!b7מW$&\-SNޱ1iNEIѮ~ئCU&Q")KLw|^{+(&iҊ D()ffff(K凇R~sEJIY/#}2QjyPJU3O{BgԣYяۤG.Y'Nfգwye 8M;/WMHed mx7gOQ5Lǿ>؍& pKPkGql/k D i[1Tc3Xlo{C5ѭ8IԊJ6՜et/JTS4_;.A.aTV,1[kG,丩+i Iэ(J7={|{ȝj4e&0Q)Չ.RRV.e%vbVq4hic>%Q cj[,aBVa[(Xb9N&O*Qpػ6{ t5-q52rw֥^4HLLA~&'|r7}5>WʚYi\> Uc,Y}nz#CJ` 7 r 31O?e0i]] uy1m,Ÿ$bb*/_Hmk]Y?VFc$wko F:,|L7lNOY{ /o ~fd.ͿbK'U39xW h/WO  m&\9/!$eK3E켈RI^YU0ʭլhE['/1p5߭M 3"n7t3CAã𝮏sb^h-?2ҀD `(f8 @A@C1@P 000@3 @ALmIqjo՞fCMYɤ|OIMa^f6iˈPn摖rh˜9y$sntۻnZ`-לK|/OR;CG›EPB#' i4u&2tlt=(/[4I24ھZjLTu3Nw:<p҂YxC+98'\cnJb~M֬BO76fkʗRJ7xon@CpZ*5~,iBV[w IuKfAS=[!9V*xҊ~.7* 6zúd Jpś˒qI,V͆,Zoe':T$[Y={̑56/A*_ c#9`Ou9)f`)4{i)-d&ճ~Թ&8X/MT@ (f(3Sѯ1b1@@31@ALQP33331@AL %s::UJ&b!B3w%m;FiY^tώ,yZpP&uuAkA1Y@dqqPrYds^Ds 3)yJKQ!f2JJ T5~rl#VWŤV} 4*j^:>=ѣ.(j~'mw{ҵ!E9;c}vbGuu4۳Yz:2􂍰#6A.6NfaX?F%abGWDn4m"eX3PR1]Xs؇)zs)Ec% ')KUN6N헁Z(X|6 LZn^ENF־lս+F]ee ڥ¹ B\ 4(8Mf@4^^]:@qT9k3MkxqZw"txj/p#8ٕ#zpIz `Qv0 L`6<#T/{F=bm]7(ԭⳲY|G)#WmG%}IONݖ|I;+9D/B5ߡyj;-[{ &\FֶBiq-pmIK)g=Jc†KNZ\B))4ŭJSSj(qo7w'P3@ rQĆK{n!4vCpy>`X-dZO+`(fxD]M49ߗy #'O<~i$:Vm>_ԩ9&'uZns+pMFwB> U4kElɉc Nj'\29ԋ%D0iSІƴG[چH4jÚES*vV}J+Fo~PB{ '5ԟ؍$Gfo po%J YlfpH%Hz?n#\C_$Yq7Z;}L%xffw?͟A~T(}يo;I;n֦ˠe~ɯ&aP.%*P<W_LǙJ7N#iAJ0wOR2I';.Fr蒍(Jry[Dhˇm_4_tlKs8Mg iv[hjdTcK$﵏_N4YJ-4'j.fd7[J[ۆZ_#c5-;QJpB5Zou"qsRtnxmJ)Ź9<U%^U vS[靈jVtҼ1$yfNjT)cIӝ8(YNݧ"ѧ4JN<ދӡ(9vѣU&%_KQt@:.&۳e}dYGkxٍYu̙؊vYT I5t]d9_I4aO31 W,a)r^p[Y0toVsS3=zWZXek]zmŬMf_WJXnK|N,O0KNMrBc|]f`RԼѨy :2_fGqǼ|xH:%߂ծy|oWsSP+#u8+tq)tzG:|xbZ+ܔ2z{%F 3o7v|!e(?K+-<Rƹ\]vvӊIBb;hZdւ&G0SY-)U,~ҺƥoY|UKb]ٶz?*7ky]gһɾ3 \*IԕepqլX7SkR­zϊMbrV/IOq1.gtR켒Ri/^O ;-N%ks,^czMZmdE_G @tR}*)f׹j4g!+bJbW͘״V'hlj7{ƁPjki<8_SWkLf#ZbJ\iNjrm,c 8&ml(0֎aɸ2KTQVy% U'^?mw^azȎu/>0kE{*|?;ʸFE GR x/KW )m>-iY:i^d{<ZiǬZ4rjsW9vK?t4s?&}d6d>EN ;Z^yk-(KFKTnXz) bigIqLcIxY$ \аi$"H$gCI5¯̊Kol9[~o:0$9R/a2U}N>$EU2yI+&3F*qoqZi[ɔy[4ZqWT&%6Cç6M.1k=#OXw69R&;ԩZ<<[R RuSVe܌R}lwQʡ,QTҶ+,췲ԩM\Z^wo=jaqWMv~xˉT)asTVZ_+yjXqgfdTBsjZ;bPT9J\iI}&n8׍~sΟ ^ӅonWOt4@\.ݝz\':vZwM*ҢI<՚=Y\JJ*rm꒻MgHQTiıY jڬ6טbY/ JEi4^+_?8UvOP}akwRrSM=WےxVմoY?Q16F k%tS1^bR>mZ_+?&MFdo_ui~D\̇~BuF'[FdtC}6k1)Z[1s齬^9(v[i.LZJ˸ ,_qIeur5:|?y~,ĢĽJeȣ89^-y؂3QM[nEgkkeՌQs|kd>c\dUg|LoX4"w^a?czS潠omr1nj=ӹm=H- ɬ9kfR&֪8LrK\bKb]!ɻ%iVjN[\u$n=7RVג%RRqF. M=4E8*tݲ{:u)=}wq $K^*ѶK?1Л52T|_r!u2tRy d뎩J;4[Q5[-Ԑa]C++Zj5ّ㾬 I"Yꢽ:%MLrU{꼈1.Pt؎M'kmCLZ$j7y/2/&S?7`Za%HQX^[]cd~H^+xKXɫƤD*ۙ crGAk憸݂R1MňK6zxeQ!t}*#Py|F&[i(I[R`.WmwM+k|=>+ )TZ6w CNM͍Cc{N;^러q|Tk7-)<+9-hիFN2j;pNRo RoN:.dqQY>nu%C$G\S$kV/VMal 6PjSF,ʙS%hbkm\yׂ0ߨVĜR-(Z/XN;,%]ײԠկ-gQSj8hdV-wI瞥% rV}<_EcĻ b_Bh*8m;hHek@:gv,j8i[]B*}\+l5G:XoiZ ӸbMm,Fv+< 2h(x/9klrGwS|.\MB&)%C3]ԭv~G(A_;;_%lc9F͘m(ͬ׈F vb)f&^5§(u,f3%W,[Fdw[mN&dpv'}#J2Kv'fN!ij'U(8= 1zJjNyd޾Şd"(:%d8tjWDxJ~q24Yhޤri:Oȍ`Gv#}Û\]r R;6Dq~D7ڍĖoQT {]-AtXGkrnƦ26DK|bx`ӗ5ݵ0Qqdnv3RxVKTm-(hŌڍam!$hbN9vud5CVԲj+(bX" 5~SPR|&;ݽc$.xIIӬWdպ3n=;}5WSOyw}0EX֚b;]G.["nM)#wT4Xu`jqŷmY)]+WjJ݈a(M2줳L9[ boЎl.l YP8 G&(Z-c!P--S F>ZWCZRXUi(;= $jY]i *v=IFr~&O%jt:)IE$hXiLE2;RV'E!vBcF6I%R=”w{ S0r&*>aHG|s69CLM87̒IA}N$cvoGĖ%9+8p"q1EIŪ%$s+AX6կ`XXuӲy+Y1lZ&+J[b,fc'k[Jc{v彂VA&B6/W-/hR9T`Y]2m5cD11YTîNJQ_X,W;^BkW̱e)<~3Tֺj*Z.O;9_t1ϖB2Rdo($սC/b75Q?R3&W%mh-3F2t)$)ὖc|:t^Z ckZ͋eurJ y/#2+GDjYcNM+rIAo/)xN"o4i̩*=OMJ//I[KhX_?aRM;5bN.5R+9gr;c I]WЩ J\qf%WK&ui\]= %ak"T׼|){m8B+b(MRn|Bb! &dݳv]' j'MU "JRj_9۹{.;= ]܆SũPKV$iV1 !# ʛc{iĝōZv5%JZ#d9\Lэ4$\#dV Do - 1"X/5<Q^s[k].&Vm=ȫQJDYb'M[w.6&ďAFfOIWbUKVŸv"~DKLRJ8ViiT3XTrInUU;$jY2T"elR32QU&ix͒ը5&.}A,Ґߦcɋ93T3ȞY."=5KDIN2(R vd?QN[/2HFJbocN(+|E*rSK+n9#wk&2.4k%j2.XygeZ)*TM 4zҨo`qMCm}6!5rrOqCK? #D.ik3%V"ƞzFF]vk ׼V֧=^zam15m,_7fIub}y|i۩yDNR=9G #2Yz/& ?p+^~ASK x^FgI]fRL3a(=߸_>Y!ՊӭcS) t5}v0pZ[BOT2Ytk$=+s$BJ./1+լD8f&jEN.Y߹X䖃Kl:LE#E]>C:| ,fHTљ]%w hFn7PI/n6{64dRz=fy"9M!'ɋEշ%[ϋJ}[C8'jxSx<Qݓ,qRrS]a:tkgWBO(iE.ZjX5ŭ*:v<'E}ǧK=fUcUa׀fKohMJN[NX_-W<'8dۍ9dv\dwkfUZZxݚ210#S[u7ks͌uw@z*|e;!3S/3yF6ٙHhIn,$5![!QӃk\r:h-"w=ѦoE+>59y#˒鿞f% rx^]TI$kr{ǂUn>>mw^\eG,ޣr(ЫQ9A^]_Ȼq(EΣj1Eg.О8߹7t:Rc-/.e4j'v_vOvxI7q-ޞK?JZw 1]Z'dFZZ2Nv_2n\i)+Ili,[_Q,շ%&܎1X1n@ g+I>nRG+,luSJM՞zoreSb>*u,=H,jiZ;eO+/,+|n P4ר7eRJUWۑ~lKIVXrGenV[i*~,<pHvа;2 }QLzre;{Ta+˙8W1<öe7)hƸl!){t>1cu=܍6lmo˭n9-Yn^s3hE+_Qi+6G)D[!^7r43^ -;5nUoډVU[TL.k) Wk^pJs[Y UqSj2v9޴a׬ ɍL\WJ8򗬞2gLLn9eIJ,xmd_ֹi1I'ҥ1P/qE`ĸ18 2Xqz ƇqD#[k0Ă:z2<zWo/V^dGR5c&c:urIR4)eV;vjd﵏J|x%S[PϬo3V_Ɉ֪9;%eV}<+VV|7\z?$7_j XGMJXcro,#L9q"ŕ?Xhۼjž4q0ݥ+:6N.4ɂ#x#]~ңQYySzr,)8kll&#'y;r~:*93w~qV$,{|+|(pnRYO{>(G2x+reIb~՛RW7^p_+_Q=XNY&'FuoLz-q,Ie[)fkM4$UҔݖLqze%ʼn7Xkc6M |U_ V|3'& n*O[cn-HYh#uxڕq[!S% Y{Jڱ5{݆hN@53i)$+e{dEkXl&$Ioj܆^0% e~dU M7'Wgohz' a{|y˳._tzS,Nluzщwu Fi4k KFE|*,oj?f>J4$buَ둘%>7\US%7CZ?2LK4$lN23 % %T97 dےR,'-"[P(dc}Q(!rLp] kKij3A+r@"@Cnc0k"XZ"Jma#1](kƄwJٿ2)I aK;k/a͖gsЦր1+71[D5w|D&ZK%fz0<ӳ,R-1i< ӻwV&#h3@In#kQ%fe~!4cJhԔRDT%ywL*HFh 2^OS&WBbfB-R*R;IeR xYJ8_4Atl%*RRLm!a;*QoKj+|GJJsϹ{ƝK!eܾ%J^Z5P+.&*Qq>'U%&T"Ն& :}Oïq5W~cU))-Lŝj][=ZE3Y-JךM,Ŕ{ybf]<)\ rzcm4jG$DNk0Mf$é62T/!agfMr)SS 59ef3&­\޶$!NSѡ,I7^-/+]0NKV=ͮO.f#R5WQ_6[ڊ'$6 ːg,HqŢ~&ʾg)*<"hՅ(ӋihmV2Ƭ~m= 다h%w\1[u\Ree!zʕhIƔڭHՄ J!=ER2 e#xt*ʛc'qR*K~#8KHbfˁ;,J8$XN>"˭NXzwg'S)OS#WFi2:gIEbb2¡!cSՙK[=:ϱ/zK8LϷ/R,T'$(8h\Yl n3NPqJ䔬x{&Jj=kRjٱUAN1w2IHtjO&-6E|0"6)ѝX]䯫ChZĒMRG$`I,I)VZ~UZN=Wt#LgGa^QYjj(>PNE6/.@jFi52 \-v}nXՌZYǝ cſx`q($\7`:5VmƍYq IN]jm=)e u$1&sDwIRI+  *uJZݲ6R\<Ky:lpmF-+kQsб;ޤen9rDL4*Zؙ m|F-Lɱa]XE;~ {DmK &ڱ]?'-"c\b&5o^ Ýߘ9oZZe'b5=rrgCwB>BI0߂y+1#+'7Yab]{=yNr; sɂ`i{j(n4%8桍+##TY46lt#V )_4fXQc9fr5ZQfL"k zezVwOmaaBQ͎\WNY[/CJ@9dY"6f 0nE6w\[aurwčF#W$q\c,jT7o.qgB/pnwЁQyɡK[G_tG,.P[$)bf'|טp)!T~c\\u([kx ̶<%!7W] t525;FYkE 10TO=<8Y) s ne> pYy%:Qoh`rQp;-pW;xwƼ9i^RgVڷ-| g pDbK$JJf 9YaNMO ES~Y cFq̙ L%e2`rق[.3ytU+8Λf%cN$$9"rvfJvK )c2 R1&@>\5=(:Jͬn/&ēM`NhI9;5ma*)9? U< #QV;YmP2ŘΩ1ф"qm@ Mxc5~(zbUS-b]m#&_y1Ʀ<Zg/Tg?Tu Zb^F1bvkw3"9 -= +b_f;Y[+2ѶV 'R%"qȅ%6/gkkF4åVJEt-YO.=ȱO{Ie|aӡw DGgnV]2fLUlq3 牏l ɝ$:xHkv3f$_)y%|i2' s׊kV$&*Ƭ^II0E3oNXYTIJwNc[dwqT[3O&2];[ ܚ"sJGI(d8x sۅ|rlt)TʞMYQbWc^=(d8W,r[RN3Jj=w^:y>8ouߙ,jR EaVUiY\.K5i/M?Sɛ@ٞCzU›Q~5}zroxֱ-4I.Y$TQ=U 2cm:ݘsȅOm"jkP3|iҝ{4㕧;}i9''aլ/0XJ7)fȪê|[nRr>$j9hM9Y\,)\ujK8 )O% ouiżK#XLE)*v.Q(ynj-w8Jݲ~4 J "p Pk29BqyxqGp91ToJ+Ȓ`_Opk8| 51Mʕ7LS:īc[F(p lYm<գv]5BL-X/[N;3ೣk7̽P#U-Ff7\L.׈ޱbŐI<ԭȍjQElV6ݍB#z, H8\lj՗9'hXݍ.55CbYYn#] =C1O1.%u0Y!TcT.+{r9N0i/2 e1whTURI"z5 lX![A-HY SUܙŌIG&f)iVz .I ^XZh`Ñ5Q7ԖgK\6x falXڍ׿q?iI{ETՐd=T!q2=]L+>R C;4DZp,ό \{$|%ϜuN5=)w<*BQ]7J%|ՇʎkPͼ"PW8ېYalXRV(QnI8y;V8e-[b:м}&8lCvv*Y"FY܊߬z-Գ|.'+[54Ym~>Zw/eݨ&TvvI롢jZtSo}3't]8ʔiK[-+F%W}HHtnYcv(++bkmžP--m ygO զҧMOokX[K <+v>4B@9i` wo+i%f:+,,ka_iݦ3QLZ/hHkc~aGs%e/wRcʕzk$ѩӶgnz4&ZlrEJ6H[G% Vw?"JRvզ^ēr:M{YV|()m4k'TɫaZ b} {x;aCS`LmZY-J-)!߉݇H3j`66nĔUÛ!qMRk|RH æoč7-x!kWp4= Nuc-؇I HY;r̈́SݻnCdݭSOF"cMf2f+$I+r5L õbE'+!Uyuvc ,U\5R|.9+';֜*%$,wXפ$ZHcy )hsY`G9(Cں̎THb,9;U#}\7ƋXq.T"Q{8ٗ2qwYx3!RRwj\Ԓi%tt,/[ד34PR̎ ^wV$lj1J]bM;JM2r- mB9#FONQr5MJ DIG #:ٻ^们Zrs`x$Y%Tҳ@hZ#k2J<ڗ+%A%R9ci-mD-Qc cr ƮOX{:q2JN⧇BiR6VWQ^]\nOT c0.hkJ=[Ĺ18=}d5))rݒa\j  Dt, [wXlZ.\դyRzɎ6^4BuEv[EJO]``f- lnbhfM.zG+䄊\v"% `fgCDy/E/ .RzI.q Tehkna, ϣjTx'e)ӄ{.MzTch;"zQİ,(JsB)]EB;=ly˙,l-֊K&3 [같G-C$V xJ[OK|2$@Ž$6YykO1WY#1e)jEm8fo̟n dTnt)f뙎QW͒`VԊpҺ̟Zpёvf; ܉TR'v'So|ID.*X㮞28g{<]Z尙kfd5:Œ:ߖlqԕqPԩ)DE$oS|sX$V rb~3.Z59f\BuO}Y)+'Zo{rk(49ų2FTz}.YF.9ݏE+]wã4ݯɒmn7}&;T8吊JL#i Mn m44$SXo4x(y!,SXj.)IU\ВzjϣIhzT㨸*b D򷬎*"JOX,"nĊJdSI-=1ނDcxo2'Ki8zŭO ? %eu{(Gg<oB)HN^ƪcq-o`Q|\;Xkr4.g, Y;Vȋ QD/I#Ta{ xkSy4Ǩ$;8fVH rx㦟rsNJNtԭS &QVs${eMfS!ɩ^2ipj '|IXlxYoN%*DRзRj%ݒ!S7j2•{!. &a>;w[Cf7MO-aZ\f61OP[R7CvkFbܬd5mOwR1D|q*7VnjW?F>c:ڲZpmYvSDHsIr'"1nѿx{Ŕ^1iK+M0y*[¥QwY,]~(EygbeE<)> .t*ۄ~dR|`hB\tc+Mwf(kaP8N$'BM8/V3 7,9/ Ķ@rj shxs34Bu:: CbJ!-k1\;i早Wk։ɷVuGu {Lw#|E3 yuܒ켈(Q'}K T6[Hd2cr-? 3,T\K>!AO{zU8ִ-eu);~=%ՑUЯ*\`vʬؘ2G{ԿЃ[ CHu[# p+ WX+$P3طkZZX :-Ň;T$(, 5Ÿ*n )aC\<7*Ov&?$ k}I_Y؍@cJW9W*'iUV6o ,5U;&GXj`L8.5=QO!RPZ7$q[?h&5Z3nr01k 'ǖmL ˆG gWܷJVcllmU))<`LKEG;$d* !dmzOKw'}m`0NgXA8'`f]zV% :mQY"fb9XpSY'|ZZx|G>%Zэɔ' d5@Z%w)MZK_X}18ݚavN7Ҭ+Ǒחdߣr s'!MO}K<ך {yu.ISVskS_^%i8h98C*m z.Mr&Q:I׹_=M-qƹ5EqL8uNo'{A^KaqeRf:Taטn R,ZCn^i?r(πWzsz;$(JIO;!>.RkbIèmcV=1uIV{ɡn$h7b`ң7ZZ#6IEG)ıZHLqV9>1e$B [32JVONj1*()+i[4#+h"VQmmDp0D'TΚ}Q ;+*KU0El]nMYXE$AybY[1G>Z*k<emM{NeV$QXz"Qj,,Ѷ*a;/\"ԘJUyl:qVLh,V9[~)<9F-^ 9AKFij`XX.C۶Djmf5[w*n9^ )v+xlc[94}l6$%kaƴ+e܎MTYv'c ~9E6%ɨ}^N".WK)/&64pߡ;1U5pr))8og}&K!mu⊬8)k1 -:I.eeVPWz#,kZ]&Z[G%g%IZ['ǵm3#q=LK&1%ט3$Ƕ6ϸIK }zֻu63FQXn$K_q<ES,Tw&qu,]zmS ڍI?qjr®1ITW^[REc_gl,J "Sk7ӷYւ5XLo_1)цYQտS1S[(m9XF1}rEf'Q9˹w4&rfI[e,j;AԪrJѱ$f^}\bb>ve-Ob+-ff? 8vA(BůW z;%+J9Dn ISRIySWWQGfnWEXI2H$2NMdAR.B-IVːYY՗xػܾEmxKb6P5Yzq N앒z-K}S÷{ZްXU 9 eњ2BBgv,1K/ijE(4jGN. :jG8oZPus%f!{ݓIXӐD)."I1^+Q[P|*d)>TO%FPI5m5o1IAx,o!ܒ4U1>c61kRV!iT2yysp4B7Ts\Rny%B9~>]Xn1DM,-1Y;>M ?4ޅCu:XZ"9,&cY,7LvX)8zVy{MTc0,&œi`YAG>[u%k4ZK#1lTz?YNh6jMI$؞~6ݕS͹i8Vʮރp1nE10{#X !e.A[$ĊD^$FV%*"5PV#t ҕMzCh'ep%wcHA[%yz(HTsY4,kY]>Kv&j-:$UI&k/ OܟrX&XQТw,BvHw=$Śʤ^vFJhVPk;QĴ0L@uq{63Rɡ?c -|ŜYe޹Wo&%Sc%)Z͑*.7/jɱ[1H;7ȓűBdavgp*fٙ2n^*ػ\tnI<ō_F-;9r6U<74)zM6!wr 1RSVr$b見f'\ߘ!rj\YLQ2f+s5PZ$f]*K3PG;}&zǥ֨l eVt5؂4KδeE:)^&hG9$s]5[̜eRVMᶗ/K2,T]&z!~9n)ZNu}fXwbwP\8FnEF6b=Z2*rx 9ϙnYV8o`v(! 6aիC);R L%Si(寬t*)bYQRebW3[!TdLIR+n6]gW|yXXϙaYXJ<z{ ԉ1?\s'~b: FbJ PO1Ц!0Fbn`I| 6zCvc)|8>,eE ;5bq:y1O{ Un(ɎXYJ}!xXڔ*5uq^NQvi"eb]ױX]¢1\ofd%)-ӷd]OPtIUk ᒾz jy 2% [<[-tӽe+%AN9:uIr kv($U٬بU,aM 2eIGFWWIg{m$])*Jl^Tn 0ZiɏU/"+9I^L);f,wU(lg,Xik rwՐ 2Q_wr+[܆5YԳ}vaX,=䊱gť׬ I GNdy[q{^uZ\[w5cm7W޺,ayӊrkKi-S)Um1r۵*0$?֫dq 4r)+c]? [YG8Eq&1;_늤&kVȎk;wVYs  5!޾Rk4- Ue=BU14Ef icSYo!wqbd*Xv2 yhiu+!,N]#pnMī@WcQTWb7ُeiRwB8Sw&I6fGSV:n{jo5-I&ZI+$g鼮 4D(]=uZܥY4 tE)vlW#PCdK0:R"9Y_benU^0RZ^r93&uZbk! xc-QffAGAЌ-MRz7n%M a$^LU3@/{DdANO$AbJ8tM#fMw=DTۿ|31+v =s51҂kb>o2of1ҿ! 2X5f&A+],5wQZyUӃT{y3jM ET_ endstream endobj 387 0 obj <>stream endstream endobj 388 0 obj <>stream Adobed#"/A1/6>8@X@8>DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDk "   m!1AQ"aq2#BRb3r$c %&'()*456789:CDEFGHIJSTUVWXYZdefghijstuvwxyz 1!AQa"2B #$%&'()*3456789:CDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz ?րȠ @ @P (( ((KJnVWR+2|'Rk}=PTzRnܕZfO~4եW՝JAZ$D0   ( ( (  ( @ ix".ت[8Dž 3*PZ:= Sɗt{M.qixZV#O핵c2-# R3/ŋCHiakWK4RN}Nl{~WOr{V8OF_ţúXZroQ]!{o.jjB*J]Hn.]_ՙ:>?LIJebU_~\e=׆JskDz^߁7c4˔JxJ*nIYe{L=-۸Kum<иv}7RWGMETzy))Z9SLe媎 ^WGAM)~Gq %65Eͦkw?_=R1=Љ]'&ԅv߈'j!;~9qUc(?#I% tzfZ?(=O-~TU+K=xn}5 ǹ Tz~rs/^I;_Y/]vQ4V-VZ|YR>6|A/F>/^2VxF DP@ (  (  @ (,:1qW::Yjx:*#׎Ywz JtU"B0Kؾ3LNOKo(i.|B4b;>f.t=%+ArHSԹ/ЕNM{*S>J󗬐Ƞ ( PP" " @@P @@p 0@P"c~G w3Aq}+tuC9v]S rZii K-}')_wXR+:6&)hzGҌ-֩{eO5ZnZ*Uv]ے*u)eZx"-vk[GzGʚ;e%UYˊ],&xe\ޛr#uy}Y&:AT}KJQW`duw|&Ttz_ذۂU!$.'ە D{)蚜ַ"M'Q=L3-T_|o<3.5=9xoE"gQԌޟY{")d]*qS [5{ʏ'*_b2Vxn-,SRI{q'Q8uQI^,&4TBVO3Ҋ]&.)pחp[q &TT[ˣáRy/b>^rK+HRˊrQprN߼$\$Wڻ$Vx;{]itz*I>QJܖ:Y]Kx!f-9.UM}P}/_1RZKcPjA;juj8P:K/F>/܇+_>/i?ZFˇ|lx?x>?iTr9/F:Rkk{9$ k7BKя(Ѡ9JP` P 00 ( (( PPA@P"` ,"pM}˾'9LI.ZGJY܀3 (;R*칽l$M>?!{rG :{N|.=վ=-rJb*˒5%YP M3Jo#-馝jUߘjfYYؓs8VJu Laڎo,p#Fa ٩m- t2nIFղELzv,컓o3j콇җwHGVMޫB4h;JwOWþs %V+iپ7j["Xڧ ׷RW8y8Q~z>I%K$2:q!*nO;RHMaܻ/gG_*w;EC˂ו|*%4ڔ? ;s9w}p?ʽ/#RN>,^⻟W T{䘵%&O7ĮTmK=F7 VTG{5Ke#LXG#-|H񮤭޽mI[UYYl0$o88_prM>*̼%a5)J"z>$x|EHSVG~uZTws>(<^/ vW] ?D~)~~c)Q @PDP@@Q@P@@ k)e.kcl)6dS*\ =)软(KRUnT+:cZ-69M5/U=^H*M{h5e:Ur wLΑ_ 5"\ꦘXmǁ:&T28UYeʘ:),ҳrK*SY%<*ʞ̕O{7W\m*ٷ{=D#զn^e&ZxVߦ9ƥ//ՕCFJvk_ *蠆%.̲]4nr'. ۬~r"KiҼf؇,ԗii|NEk;yN*2Qz3SL2^ǣ)aF<$쫣PRXŪrrj%Xno?F edZ_&J_V w}ȵf-&mW˪-Q%~ |wX)c)mn6qRO}mz=SY^o6Ox$C믜^ܨi%:U{)M#|%S;\v)G+{%B1Zh;RQvr- 5kϦp GjTʡK=)T#y{~b?E~S~ᣥAD @Q`(`.PQ@PA@PA@DA@\ ,p62jҒ,Tq,szcҺ UmvRvuę:jvOe,54VcӘO=ZRG*qR.Kb*ۄWǙ^뺚SW\?8ڗ6vJ51ߗkcc !֯ YUFO^r:-:u.Nĝ:Wwv[#Rh.aZ۝5"%ZK(hw6 s6ERj] 'mQ"2Tmh-zXIkf1`.OrgJueOf!F3i,6"jMz)#RV9IJTeә.KQNfiP?S'¶N.4˩ǧq#F4!^sM}/ښ:K`)ƳY[8rJ3$ʜ2j,{leG3m|{ǹx_ՇW (NTegWAx-sNRLnfIԦ$唴6:Ct#:-.ui9ƒv"΋kJۜgpR%T oh|9N1|]J*\.׸%|: vWo9^t^kSLnS&KU?E}!4{;$ԭoeW :*1Q$[/]$X?^9+(ŧ|Nye;~eDu{1)XJ ((P  :S*m+dZX`)MZ&q)[^$g-T9_oK]^%n4󜥄^m,KDrl~:unMactJ4: pʕcM^Nȉ_u|;݊Г[*CĚ-n %`H]rH*d)7!ntB@bGe+AՀR@Pe QD@ "*c"O؉Lps~K+;=\#o0KUuj˅4MEmzj'Ҧxii*,fXD36:~LN2jU#$4=ɍ÷%}v:/E/_e_UtRmkk&w&2ߠWj#=8aөwN؏*^s+x+Ŗ<%⻀R\T\l XXldD\v"˫{{j=Dmlj-从۠@@AD @@@V  ( :svJPU|Y91V8\)Q]\^ą(P]e T;-D> 4z>ҟoJxig|Y>(a'I.KƃQߒ+ZhiM~},:\ʾ݈uqݵ[URZElKQ *B elsK1F#܄QGbDr-=Dz-=!l- oi( ( ` `˝7uэ)TROM-πRJc-ԓ!,Cww+entz%7$ᰱW E+YBfg68Zq NZYhU֨tU(0lE6y_ߣՍG_JJPZ' . k9y6n $BQVޞ.P<+jp7 Nj5<#ZQãRPفPhmI&f0"eMGD%RJ :`V;6z1fF5Ks ڙqn9m5J#=ꕝD0DH|4`&夸0i qԢ9U'HVqb^2VU=g:W"t6ͬL{/ZSS#vpreU9I.+Uêo7jq>qIZwԛ u*ldӉ*:!p㝌W8ifE_?CGŽMjsmjt:Äs_? {wy.>럼l6~ g2;IS^.k},,d7'j9s AYЯSWw$tkIj>z˩q0ucSg fԊ 0    `1Sk[ Gn"&mٝԩEJW\Ӛ_ +þ:fi.g7rKK+84H`!μ9뇤2F2ae"ѥ*.<7Z?E *1U8Q iJ9{i2k3+eȳy{$y{{]VJ"4$?I\,b*$KZB8WN XU9Ҿe~[L8w$&c15z9qz!.6vG{*T~6Kw{IQ3On}Y<7*9I\ \?sʤܝ92ug_܉X{8 !(((  @,(уWgXaݳI^$tuoئ~&Yd;֘䑥 :WWŊLSy$HVIna[dT0qՏu|>Nuُ[bڧaUB+C+⽫f)ʲʭ}жR{l5IRhcBƫUC:k5-Sq}*-;95a@+-N{zp椸j/a6 X.зLcWeh 쥳27J|*ߗuētqlz !ԫ}פgW\"u4:Aq9mXNiӦt$J chL8﯈On7&}:Ol<]XJ๒75gWjk͵SuV9xeOIM9 "ǎqAE[J}_?TOEc% ˪Ueu\:&Y84--ċ*tUuC$Na8-ߔ^6㏦lk.:x+I;+%_^"$B<~?pW,ܸnS~M'_M1GEDJvv:0s>x@@(  dA@F.NVik=__NYyV8\ѕ]$4Ǵ;SRAY][*%nNzs Xj>,pG{ b.f~6$0yj: ?Jhu%%vB[C^Rh؁_*GEωnVZ4E al- * rcnb7YP=D'EE-HrQal-[%nDXhY9s H)uzJX]/\œWbf #}z\gIT%!\N+S'#Ʈ&4*zظZjBOV*qyHnR  @@PP@@@( D@Nuip{5x U:*QZ֥ٕzTtWIg4+n,d՛LM6OVg󸦸=ăWqhɹMDtM2Sc03d.N1zp"bk2Xv[SI[YXnWT#UNZȷ{)reG0GC4&i9=N!% H $)9v['rGR^r|@p:{EG{jUTWe^57Hsn$nWܟѕ%¦W~Aa˪R|9$H &;-n*k|Gi*Ԗ/"vmU1Cm%VHfiAeR&ZTe(p:u!ckYSևSq٣.cE3VEi M7g5 8uюY^N4#8XE'e\F(XG) a`2Ip^6c)(jܵj566jlԬ#95G{M9) "zpeEp>t֌Hs=HGMpCfuGDKHq:Щ[]shGf>\ ^#;!^E\لj'(fc[7)Ta+z:)ts^|m~!S^@  ((( ( Q@}:R[ngxaYُ7\N&Ko>ygf9uǺǥeY)gj8 pFwiarﶲ:eǂ[Nu.~͝)P-:6&#eKbaCzr5|\(usiFRU!AB+`(MDd_a7,"FG sHP:(!lֱRQa,-epÒ%jv t4Xu,zܥtĪ'k*mFY*E3b+IW09δiNzӡ¶*ww|3VZ'qBU\l.HyjvǢKsRy *QKt_T0i ( P (@h @@P@( QE+Gk(+"oKBZYimSQ**M=tj iқwOqC4Zsшx֥3,c'gUeMuq;_+O,-񨻒0;Ν77bu t,ӛV껝pxg^WuaPn+VNFO$=@-*W-Xu]tlX %vzEs8)pf+3ra&]vsa;L<ITQc3Ҫ'^8i>Tߴun}Ü88KDŽrrz#8M躮 ÞĽ.k;-5Xd#pS* jF#A9kT5}V%Ӕq:5qT.᳧a zӹT57x`Shel̺b jӳi޻eavqqhG805Sh`XMfL-q 0e`Fds Wi pqTe|d7:b[=TH]K*lq%æ*VJ 'vRٲϢR,%^+>2VoU̓.>&dtrsup` ((0@A@A@@'-K3<Ù5X-_?>1bZ[&V;旨Va[r88ytvZ/,"T 曻/ 3*jg*HWNm UqzAi͑u( !oaͷ0#WC#tQtQ*AGQ:$TXu -F{i IbM: Y+ :I.,[94[ ^uM$UbqGM_Qխ*4y6+\_M^꒵ȧۻ|Xg8WniGUdJG@Մm29H轤7;PՕ9 @[Sjf()>kaBSuiBẅT!h \ ( Q@P (  (d "SӓKROK%gy:X:fQࢽAZ^֤[tԝIYۚ +zȸc%:nʅZB+"f&hǫC*\ÓY3 u寢g<%'RDn.0U6> OhʼV!Qndє͇z"X}>:ʋ9>HJX 8h/V|6@9XI_F}SMvřwv3D{ DDbT$=*u6~-)8Xa3B8KXb2ـ105a+݉a=Hc&q1K `E)  :EŶOat;SЌZW̓ѯik-kSnJéԒ::m  (  7!a=grsXrqJU;Brrي\ėC~ß>ҟoNDhPyaNhë́v 斲/-s=HJh7 F2u#I]kcM#+B]lT(%__,FGF“nJ(X@V9J:Jj')MEG##tQlTiGXTvDs0 8(hq~D`텵HEj*쁊jX{ڗ%8}L[ElMFt:ZC'V9.nȵN=O81#IUŔGw,pc]>!psquȬUד݋7'%`pyrZE \]lݒ#bo;[!gxL4Ip 9ac(#V/t_t7N>m/q$Rg: -a*a9KzTQ`n(dB΃q O-|dMђ#OBR\=^ZƑeI-Q3UV}>;>j8?!ٸFu!=ũA٭QTat$lІ[];&g z9ĕ*m֎7qQsB]Jdl CuU!ŋ{h`{[3+ZvvhNQ()MM]+szCGd0?!F{Z`Phm;4'3q)ntjsZvDc\Q*䮃X(#toU郍q  3?IxҰ>Iyl4~d5wt汎tHP   FY[\NYhJ^,)ҕWduAfzGs:EBڗ)z#އǥE&յ G3-N ,y.c\[HW79j*h-:r辪iR%$=l\)ia!j5i _>Zէwܖ ;ݻ@UA$ Dls^Cs zD#GHĩl+Ei 2\v}"ld)l> F2^OˉEói68ѻKrҕ1zz1$!+OEW =︯nN-emLTN2d u5-X Q5D[())`Ņ)LNoalP:\. DBpzBT$- a2ӈ QA.4..p.p p@AD %@@(( #F25*$ :q9;je:]Gj$x3)Ҏ|0y6=GRCGBVfqgl՘h%Eav>hq ;Թ4ƕY~M1BǬdBU֓."+X^zEtUsV2Z-ZGNhGi+6qy]:񊥩шf)B=L6[R,p,H 0]R=O"lёuqw=wO% Er_gc8K(yzӈc7jrn;wV8X6%FT5~Ȓ]ה;ʼeq&TӹcrIc LIK{ ݵPyn^C8RZ;*I-~r-T?ޡt9R}jo^ձEEJǩؔ3lxEߙ (I+*4M\ɾ siN%})SdRgSTqtkՎn6Iw}lζTc-GLGM,4PyWT2E u*ehfTD uZI 3وF[?XQqRqacRP:6Vts鸀:іd42MtGH͡5ŶP=J)lJb5jNXX۱֔$# Pqkp5|bUtz]PzWBۃԌf=NV  (  ڢnR?b;7|YޤW-顇W9a$[q ʺQ'jxW{x;:[h2m% ij~~gh+9SG'-,ʶ$ŤW&ݭ,I^vld 8Vhɐq%m#"wv7 _*-+ aR9$0sG-'!TEN#H[sQ:(QRȣa a"ڲEjӍ: :NjTN˼4ik)Rq8V\EEJIcI)v:__)BӪaGw"6Ut[&w 1T.>yI5ϐr{XF4, )4AB밀 [Ô@aTG( b$q.wLEA.AAn% qqu. \\[Gn( \n("ph @ 6(#XsIF2 \*Г2XꊭY5MWv"}fzϩӹ]"aR'/xsZ2~7 L8.*N5'a\[]U k wJwΪ(:|SR^*Uxl3+p[F3ꡲ."hGY 7UqW*ʉBǪՄG:͕:aUjjz2$6cѰ-fEeZ''" IͶeI^̮a刕Tbhç*#ٓrW]ȧj&;IN(#OFjwRqؖ ;w3@6#|u:*w&eRC*v9)8v)}_4?+r35 u֜q+Z_MV] '5IP{nqO?=9'(Uq~`–/\NQW[a/tePNmVz1j wx6)M*2Q''|]]4#%B]9Sqc20=Jթ-N9ꎱ㾠5cB&߬T6Hqqx\,16<2է}Q F Xy9݁y8ΛmJR{j7Q: X1󢞧%Tv̥C]-XM9@tk|j[e/ tty3@ :A&z֜9/8Kv%`kK ͊ JF6+ Ͽ(g)Rn2[ce:Ҩ>T}"Xz%&ߊ:}L}xy[hdQ`( 0@TwT5rsU7'(SGdu/gՖHGݒOW0ϫo? S*NoC\ζt*zA_+ I[㽐;hoJo/ؒW8 eZ7AZR?lUy 6:F#tQtP*AN9!l9!,*;C径SP6r8Ss$av+}1KuԻ,%%wEV+!OJ}χ)xzr[Hgi;ݑHO['['Jq ǽEu%Uݻ zEfl͔ޢ9+Y 6QZ9a9(cFۏ[3cI-Ψjr(D-j*@ >X$f;  f ;{#ׅߐRV!9m\A.6du1D` 2 p*auŸn-θ\m pp{8.6p( (. -ln b \dF 0ʾ%Zj@]^$s}^fK꿃с7 W:F>QtݥuJ ӍeJchƌǩ5ésR)u%*WR^E—bqk2427+q>9p6HF*ݗQR+^;epQ'pCpxDLF!%v.Nv%jɉC*QGl='QYq&ԩX7DV8uPOvHJu۲ 0oy{Ѷ\jmQ6f+[W~WKkV^$A9utZ*v:G(cEW=RQ(`RZ6dg* 1#VP)H Gq_tUuR{O"(TE,4pO͞9w6UJWUCE{&GDF}t&ܑJ9cerѽ>i5)pkaZ>dݸ9Um= 2=UK 2%uts+Nn9V!sphjn;HKYR8q١>Mĝ @ R*u JSubWlXԔbޏ^ΕV רXfr+jT (luX^-X*n#s4LN3VP9\=N<_pIE&RUt&ɗr1p{*em}? [%wNzK>k#ukgl&'KҎ$5ד1(.:GW.F9M6P}~L}Q(Nr9T헴yOZ(D@ @@0A@t)ʣW96i\\4ߤZ-9ަU/q]oA=/EPv\԰NZJ:xUk9۲\ .]HshV])VΔFrLݕK,oX+ק+QWA ѓbߨM|sMSOc.}b]x\ث!J1gR;8rIsьnQ?R7ENђ/2{8qyCf(lt(?b26UX/pP,*GHRsؓN }ȓN\N>z[pb+)anyrE6/jb/ُV܆)S<I]cGVO*1vDV}\L;wĶuJgF[F7 9Cu 3zLm]qɡ.53ŧqofƏpT8lGRPGhaDb4 3{kbCw$7[kbaCw.%u~WLKk ))=V-YAْԲekDjmxr ѿ\A ؔ[%p\θ1.Qd@ȷeŸ pۊ#8AEqn 0(8F !DA.un n60b(1( a,lhа Ejf$}RTHi.eֽtw#9pC a:QJԪe證o5V)rSu]!7e-ѐml (l-FF^%卛?G,+aI (V!aנ'}eܠY֓ݗ'׸skP=Yx3ToP8h*m)KCӄ֌$Ξr6v|'3ّ6%CcRqt8ǼƦw#WLaE7&a3(7P|I8ЩRVҷjk9@+RWj(8ՅK-Bu&QP`zIU#==: 5e-hP{wp;G}<*8\ T$2TZԮ0Tu!ʞŅ9tӗ6: q9Ͷ{sEC[?XR(ljTH1#9Cc_u889Uq;^3ٌ+٪^G 5*D&rkJ'N2p4%VenOX/cY^FXLarg%Au\b#*rս| %5g!bp:t|3qCԉ(Ԏ%)qN̵. T*,=y>T˦M!K$C`yi\u:`1Sy,NΞ;;f6 X _v4⇣+!IWαw2ȼzv(k7nY"_{;R9k?Q%ԍW|YϺ6 E{z7h+?ުU='tf8P'ys1uI^N Q-ȕqt\b4cbn@K62.O(~$W)ꢧWV)q[1%Jxi͎hLvyi9ƳJ[W#Te8$ү FSLim١%K^R~I}T9!au)4m:A+薞ehI7[4|~F*jW}[@.FylII,=rn\QޝqucF l-M:5%l]yYc:A. d%}J_dEz''ĕS7]RwCuFM am0Ha#ُx,Duw ҹaVnvS=7H(8#V*jkMCCv!¬$b ڤpJ{jDt)CP*y79JWZ.B9 t⩫-Ud=;m\s\o|$Uİ{Y 36;Ɯe!*Qqj}ԋ8 F[J4v:F[xlstmXF]9ҾP7%7Ocq)Sܠ,OU+o}yfjw-cu'JAD6$*}¸f4K~*v9R]<)R6:,C XF#͸5[]rxxH(ܥ-P[$ru:~ ÿf>ZF$LmJ:meO<=JgrC@` 0@@ (XzwqYLguLm5E:$ݥTcm{xҍ)F8_#>Hѡ*'aUFQ[Kw’jv#kGu}Ni+!bR^*ߦVc*mwʶ.4De_}!ZcFi;l'{-qR% Xtw9y͍ح8I+vah]]"Tnq;Wx%Q ~33} $3HΞ}H lSί )+[9E8:*qTl鉣{DI&څŞ s9F,@SUu>e*b67ڹI֡@ 0 (@уW :B.oc(7xqxyVފ> *o.o<;¯ۭW\[I'%NYbxe NR[jhbĚ -#%i~&6;_ei=.Ujѣ;ˊۆw}.y|}8B1+F=ޅjٻ"5cšl-2uTRkĚnU0ؕ^G TNv"/J4ۥʓ ۊАi(דZV_YU:Qsd Lj›d(}7Fsȯ\WW/VI=F}Oe>:Ji[z_ 1WvvWY]JsL鄤Z\7EDTtm[eBj[>>C%Tk6qi 6)m>M*_Z02WM ҿ~|oH6ݫYrJ[QOտW:\]n=Do"5i%B s^M[ۮ!fT^ 1rTS>"JY8h r JDSSSVuiNKU4ـڕgRFp}mӭ_QOޜDiGД_M|G 1SSEgLBƔèh#ӔpJ*Չ\M(G0C:(=!R%0Խ:,  )  hFT8jFp\[pFbF  ( EPQQCӹuiᣫ1|&Yq[î}UX$(sSC3:v#JNn7q{B oÛ"݆6V:nK@) uzV)KGtRVIbT;\F zP,?|T9؋:OT>5GɛWZeJ*{F[3A2[]I(Uo X`RqxˈR`6X~2SKĎ鱮޵VjJ:RpxB^'EGGO6LXz}%I7ԩ [js+tUspOMujKGpsvz w&0!RSExUc;fxv3Jt}uGو*uxD̬a3z=[R`:3on[z_9ף*M,I-qYeކ垕O+EL|)<ڣMz/HjX (XQsetPv #.x5Pˬ\5E ݝ;f*p_s˖!(G =UOAi\֜[~s3S(,萻kbCG EEK+{)-HqJ҄uwnngg컻\iu )owvm/sRʷ4$e%Gl!)z^s8Ԩ6Ji 84?E%ZF7}Rqg5HMN,m\!:Kx؋J9z\|IkM~6-oϗUY9lw'.GTIv.MuhK?IҴܫܵu MIY6"r4f"ʞ*O. ?KY)C_Iܛ|J>ƣ5}nYt~>"8_MQUZ*JM7;[ʘxhM7obHδEsٴf!tչ!NSUf-UgetU)r4VRMϓvZ E]mY+OwRMw.8N3҆"%JrQ5nN6bR!*(ZZݚ㛃rR_k %xjbRͭx/5QQQ75\:.)Щ/G^U<RɦrJ1x$A<]/bkGRٍ/u;9=iAռ>]rVOɯhRԥF+m3}nOLSxw{8qL<_m Vug¥,i+z )ң85ۏZ:Ohdx5խ)%7Bo$a&εzt*WXM(Ō\.,a)w!E [nITvRPWz" ~4.Bkj*bn=#kBFlؚj9cJwd#N1cQ|BJ t'}t tF (u;; IEQ] 4GJƢzDul 4a="Bu'y*]sBռl:6D‹fKcXSFk)4AD@@@ ƶ2#[Q CE@hVѺGj'^/BNWI麽^:;؈n#C"Qyis:'caYաZs q,KxE=}j՘^]F['ӪNU]Y6^㌞SR4bhY4ի<|VdJXeSrݜ8ࣖ:`$UB$v"Tp÷:H[G:QG"$qՒN3iƤPKVR{Fг ws"BW~dJ8i?Z˶,dd(f.4n¤})Io1ڕ/%pe:WHPsP+ L¬bK\&Ll5h5iR-:羄ua20}-upnpWb6^9RKZTI5g~K~tD{zRAB]R5lxeu1Ub98v;.#eLd!@5+\4UIĜN̟ } NphUbdzX>ᒥavR9ʑ#ZQ Y G~3Xr (U-45h;":yNVqKg XUQO3%,E=-s_R=x eZ}b+kRȵ8W]~)7Wo &5Zh)O&oRXt4oL4i_9fV]e<5<4j_Gw3ͼާNᖀPAD:9u',3㍮pW;*Q|Ztv`M2oͳ ǧ'(ʴDaUXu->!aIEw͙mm1!MYh nڕ#I^N:Դb,*wdceSH#(]6:L)_&pkv~PJw|SҊ'4r{hK}Jve¥9]T;*3;KF] R57wx]u:Kѡ#)|y_}֟XJFO^LՒ~vIegqj)5x&1%z**mٖE/"#TZޞdq:. 7'+Y9t+䕛KVEcֶՓn Jw^x#.Cr#,h> pM1QTU5r”i:)]ߏ4B>39JQO#Zzu]]4航[1:4MqV.tײHeEs=]r\S^9FX38?:P*p^Ms(KrĪQ(~|TzRҥӒ[N?ů;]Ϊ91)8r6"9Tvk7&͵nWQZәrXAsD֧9B.)mܗ8e7 1rU"=j8ª*%N\Q55+|4wRKąD:5]Jyn'u8WJz.J[:5 ʕeڤ$8Y(DŽa4v=ռFܣ^KC]a];eg9SsՔ8 ,abif[gI|:z>#׈  14/خRTo Wg/[?[<7!J/?ә6NwoԹ]aNt7#>WZL[U:)Wv g!I]6u(woY!YFh,ɮ=/E-GH+o4nO4αTqgW~quBu=+ؽKw* .nq^4lS*-VRwj֝m%alN rQa%577 )n{q8JNJ]ZCkƔIoa=c4 JT礡eskai8jʑ5΅ Ǩ]>GJwO&Ӧ֭k.!R?xIQXm5SuAj^|֜euNrI&ғ\ߜ[iN;)w63t.܈9n c9 .z1[tBQ܅x^6xzr79xwB\)3B{8>.KSҥq~,)cI9#&Ъˀ F%9R ;ET4뙣+CY="U8{ӊOҋn׿niӊ-$*Np}J=}ltVaުp:Njª^GED'r_G+Tq=hPpI5/WG.ϓVM=8KAU`h =eBA]IK"I:yi<[lkhI+w^n!@\j@k9!D ۝!BSeŅ9OdJ1S-Ks:RSV\'R4v"/6GN,OC;YrqQ'Qv35E syPq:S6Ha4P^Bl׼C(B0F T   PQ4[-ĸQ@ Ɗ Ȁ(ADYumN4%9hgCҵVN\+ \&\[6hUB/⯤1q8yG,{4T%R^pF|*y/?y[?AaOD1.ܕOceȈ#魣eݲ"u1\rEh5)?I\8YjI_&Um.ۓl&ښGaW̮^5p-D؎j9RIiZƫiuz,ES\HImNҦYRxJySNg)WVjzK %7+ُB{[kNNI\W] rƥ9w *9iJQ"Htlr1V&\u:*VI7EJ.W3.aeA8-Ο(SuoaWW .̽cFƬ[c\S;-Pk;dTC)cU=δҩ#8 fxeuAM|ٓ<+V9CceWNkA 3P=JeN P֔Ccá*vftefu5'E]=רGE5㳪=d4sph#RQ 蕗OՙNjHճ_R=xj0ՇΙaڗ󓕒wV2*yZ{,k:m&Gb*b9'Yɽw寡Z5~]bѳZlMYR\tr1ؠ(2 I]1i;A]F]ILzvRQZwq:B2;R曻;v`r8He*0«X蹿Qw~QΨR=w|ZE]UqZC*J 6ebrD9WEKI$ rUI+x=Cr K;)U]ؗN2PѦ+hJiMXxcCQM=u;~6d'KNȲEJwCJ=dN$7ѵ5]:1Tbn6罼89O5]z:Qt}hȏSO{f{RQP+++.KGH)4w{-r(-)軷*emNCQ`9cMGV  ΪZ$qm-:JDε>Wƛq?\aY%=Ex+¬u؋CNZONY%IG'o=&2{MĝzkIٜ<)e?;4VΠ)-%]`BT+GJJӱiBXIro,)ԴS*OGrQW҉ʬ@%}IJUn4$%k5ǫceAtfp4W=ļgYJX՚u}U-[@NYҊNn{3ڦ<5L*Mn;%c\)b)uoqv"&9V|Nr+jEEUٜkqpZ8)MJ&DT֏UJ]UPTn9JPt"3pb>* 1 5+E=ʕZw] $ah)ntQZqtX^KB:AvuN:|. g(lkOOѭfO'65ԏ^4 X*dXS+ۻ]Ӽi,w}Y<52Ͽ~3b1ǻ6@'4:Ɨ3r:s#TvGhQvVZ!U44}(YSZR]4u1JmY3n˱:e?.KoY]"ݒaYdշ-0s.WPixŒ+ʉB5cb*mw[=NZ!X\}w/wevEqzJ}TS*m/1g^KUDՏ]*ԲԵz~qK*0PvoUWξr#fTDةwn jHoV ԑ:]:yimUNjI#-# #OW!zTr$ttׇ&p9;Yx>Xzs]k-64Y%YCؼҊW'^a #,Z*Fœ!Rf/a:x$.FŒaw7E9Oc0nHG*RìbڕcKVB2u==VVw *c#NndwU9O6h99 :J O}騝xǼB6K.A3->`3TE6qsYѻs`A@dF 0@@" @ @P@@QZ ϋF5p[.{t:xp+>CpR0m](}+ڲ;zkqHu_E[EeNr}g br9][q I&t8ƣVo}mDLF!{q5<:bqnvXvA:ș j:/XU)RQZo,-;JYBקk{*T%k\]~9(cIX^܆{LY+ZS1ZrBХ)\a0YsU]!ixN&_Q)=U4:v9uy;Sŵ1R7 6&X(I$Wq4ZPfun:IK%AXicATc, ƣΞT*ˁ_̢?U}8)vIoMU%#˅wuNjR+BFrq:76+F2Vh8_d rZ[1%z.J5qєpSR:2Ti8U$|,6\=B3ـ۔jNܥ %seaoTq]=8źWk湢BJKt^G8wxr"4N7,,Ȋm:U#R5qOYS2wЩK(x˸EETƃkQ/slnK a.c7Qpۦ+kMm-NZQtUo-GWConfh*tj;I-ŷWh)w-Gژʕz.#[)& M7NYn^;+Qv@qٖzM Ha.mJq>BSSQ,VO+a0*)㫵칽˃n _Tx7t ~Jy;|Y_'6*?'qߋ'ZZs,<΄|k7ʌ=z3 ^('+!.b^ڽlTd[6a麎)s%6VDھ 2/Y,Ed6shNCꬍx"<+-8'9Q Tm"-4pv| 9읯MSM(C .{- =<:/:vW74}tlvfš6sQU1 طZhɐ*'SHW$ۻV- rQ-j#ܶX#20:F0:(ة #6aыe *-zJs$(+Z 1 6SqћޛJmY._|ɱ]t4ЗtߵYg0Q}Vc;5e:/Y=_\?^gP歯KW"Wu-]N:W^hӶcB[ %^JܗR$wd85\E[NHm;Gʣ\[-PT,ץŌZaB9{Uz-;il[(+J6Z9"N4 ug~W1fQ"wؒv#hƦ"Uw!Xn礎Qٝ)HtD_:'WUg&XtcE{NON<^F$vcQIF+2`m8/Sjq:z+E.:r;'@ {#uL͌q{C$ Jb!qr{cGrJD|h檫SPe-nέv-Nλ[G'PN*b/2NggOthoьj{2v? i5̭e{YX͡k{HՒtU˸|hgZ R Zh:Y5zᲓ:КJ3|vy=9-wZ;tα(aTNԨJbAƊSo*c[NbZG /GPmڟ)K*l4!Y^)8Er $vY(b/!ݺe{0SP؝?Im 20jȵqS˻sV&Z%YOˀ5@mDYnR{##`tH[20:(rC^dHT9aE@6zGrBL)ljƄ\Kǵ5nixUywq)q}9:S|1WR0KW)E#]ɒi[Z LpuwzQ+^g ՕM刍 ө)uwK jK :칲B,>qM)\-L\W-e1sQھaעQʦ.1wFYTzBArgVU7aMZKG *z<7{Ԛ2HK!vkT;S!,qhZS{YtoI<4_*iN6+IRdSmbhG׻ܯ辐ڥ=bOw:_GK ~dtZ-Wt=;(ѻOႆyy#%O<ۂeֳænYUC:&(y#n^+gHa*ֆxZ*#-jM";DuaGdDGiTXqe;cEӔSVv->- QU*=iy`z8AYk"J1u,bS~swc*DHDEUJZrW-.*"'9gT{SC+ b(رcZwD n+o[=H.j"ޣ#HoI-_ittkAEU'D-,Μ"tC[K!]@9.R*dEITrG*v)ٝoč(Mk~VG<| @St|w; ɔ#WVV]CX]t</KV9稟ѝGSf|+:S O,iqVKJ%B~˻V7sL>i;خnBD\6c[oFF]΋# 2Y`M Ko-} OڕcI7QNeSH蹽Ǜ-rwMEJ'77 eyTd+[#) сS8Q"vD$:DawcN9aAGꕊ_Lӣxõ/`TXJ DWNFSW{zN6)QjȹgwRPWd:G^Vʼ7KFKHsnjO2$7-X`a[l00{##<S1};Ծl/$2+., -Ym$j;GkiڥM/xar)&tsv\1{H u9sM#SI$Uȵ:+W]10AiL?F^R_]pj^&N~:Y[ d|t}Cd F';j<Ӯ+/]X\Ijqá'eTGdXS=bG{y^ļjUIUyK]Zpb1\02=D%sYjkJu7v+6rݫqU#ZJ8$D$erSl šfΊ79MX`̖Cs" :%@ƽuL]H^r"4TfV'ʹW" K^Z{%Ÿ'HI+s 8 |ckxuL4z;)+.t*+UO?aW4. lX.[V8yISr;BZ*ِ1Lt]Ln+y3GxdYJfU+00*A8~MNz-:$$UP_q\F.Nȓ 5; ;}!O\=i&1Kb/iaoڗ%خc} rV]%Wv\ 5llie}lTh>:0jAuw# 8sNyFJtTYUsGW`bH]%dČ8֧WpA'u̵eqg Aٍeɡ.WiVk4gW:ac爌6ՈJacOmYuSqjW]Ď0=]/ծ4pؐK jqҞ Uzj HW)1GͲu>QYnYcAe)~Un%Қכ"ʬYҞ uoX>U1G :m̙zO4j{+ 'ѦE=QU^RGneEmԈ5YNK^rƦgA98X >TZ9:5%#e=רsUV\їpd$XegS4=8coF{?7ɲMJ{֖]E]S]?gkMէpҏ>"J4XXi]l^UԦvXo[(ﭹ' Zת 5ˬRVj{;>!H:CsnTh.#ȥfd#^f %"n:J-f|xq֎t{dYB_ٖ9~ںzcsS].c UB۟F w]+:x,nÐmm_Ivc"Ru5`m%-8J\Ru1 9ao$$di%q"3anQ%^::x֨mF:G *˒p:E9lL7ԕj;!a%-$C w#BO}c$^1r>O.@N>lZּs@P@Q@  0 gVSbZ7j٠4J,LN_K.қ&zƌԵȾ]4VK=Fk~.6WrN&xݳ?Vxgw\O2SN)Ҷ)Ҷ2ֽڱXM^tEVSYp\9Xar)۟G]R~H; II%5ODj]r9y7_Y&#HH# n.M,7v?a-"iPgW܋´!MY -fd&iU}KďJ|JLt xvhʤ[Kc6Rچň i;89_Qu)\z\ZJ㠷$%;qjIjhVU/7pjM,{KAT,ՀB1J+T~Մ9:C^rAU_r,I /슫Aȓ(9)uß$mV[JIF*F tuRo6Y`𱤲юUO~dІf{΍)NEӍ7+˗Ŵ}dMn~?8XR-lbu~;՚"LsV\Wyj!6ޯe%tTHc mz1'8P:(ة fFA].\u6 1Ti!lNTo9(mz춄Y5׷jU{}eY12YI]d,i1XE)YSQvץm{{;]N6GӨޖ#JbISRN  . r 3TGX[  %ΰΧq"8}@!$"6&L/Q4 SHa )lI(l. nΪ*;!@1Ljh׼@@@@@Dqlh:d +ƈ=+ ųӋFc!N!ʴ\ޓcoe179jٟS._Kr۔^#N'T`n [Pri-[:EjCg^tLc?Ӟ@DlPH91;U|Dëz|[QuYFaijΔ(F3Փj ݚB=_$; Q-U&iJZvqQwc7/'PeF_gJS柼 ӊy!a:tsjő)P h$%t.a*Y3$*M>(mH^L s:I ں$JwG.evL|J}7t ^:8Wze%b+W%E6+`KΆҾrP蕅6Д`dmُ<ՙc_U[= Uް8Xf+ˏ|]^N -Uؽ[w+v i7:wzlԍ%v qƮ&4t{DZOH#lM;UN.Hn @XNnG0l"UL 0:Hb-=DrCMخ ,tE :NP%%wE~3n1KQbq1O&rmqS`>|?9ITĻ߻9+_[uW&9+RuAVU5ncg{`Բ1^z!(?E< Rt݃f#%Lr  Q"a"+vQ.,b4䓞XжTqwxW+[W;URv ECƷF:|ecm;E]O3V~>(xك)8HRW*k-5nՓ(|'d#EUݻ]M^QdZغzr@;DκHϼ[R.HJIؙz8?MI uݑ7t$rRzAeDKJw-ʝ%eʈnRd]7d9ᴧl\dI]jM"Iqd:f܉T-ʽ'pXj[Y軇j  ^*F{&I9B^cPJ&j{.M"%-F2T@S:n#,ΝtP>yItJWZ3qq" $~=Ъ*[ O#Oe8ilE'Kn Q]C/EclK'HK¼<"K}}?5Ҥ#U78ShN97Όk]pOaΕ9L źb;I3ovrbzEفetSDXʇ(TxHrC~+⎚be\9Œ#|Q]g2uiew[0K U#y)rS R$9 BlŀKvS,a*"l0!MDnIdK#N0ʳ\b֦f䟬"V>)/HsQ}1j١XKEqyPdj^D*k$~7[&hOV%wVFRUUuՄ;ԅ9AcIRs=PWe qg(hb7eBVUw~\ A&5m {RrwnKl2@6trg!0c`tP.bVE H| AbD0oFda[QW{"vi~ѬXx5y?.%/jbnfia54hg/*xadcھS:ۿ"]\#IIhVO}٭1#m_UCvȏSR˒9ӡ:ܵ{;UHWqYjO T~HlESV.|G@ޖ+5Ge% )F uqJ,.]$#3UJڶKGFVV\ETWԬ7vvDBn(۽CZy;^L%=^8vXuuKmҲnWeFŞ/s?EJgp(= GFr}B=7zE:- ph ,I}%1U4<6ֵHՄzR:,mN.Ce :MXt~5z</K| %Z`6Y%mw&+~Te(b!q=eZY BbA=Ud]u299s$Clև98iG B3uE&VYZ'>GXrB\T:Z#bFo@S\kIʓ=߻NQ>|ZנKë3đ)/Y"5ŋ uzGYBZNx˝sudFaGuBJ'.9ƌWYV(( (ѻs dD ($:´ejF12*bH щCbtBe&ՁeHЖ+iJW&qh8RE?"osb-c Yv|JopAyԇV;f5`L5 !,l]^,Frv.7Lm?%88TW&E ˊBETl k![+^DKoT#dSA!&pVG*=ji5aEDחP❖gEn!/ã?dn#j'7RNnn@s`TX|`u $T$9+v$ cNq~DbPMLgHShgM9^4_YSNnVɹ m'}%"Jj*c#nʪWiOOH5uY3tƧȩ4 XPrܓF #¹jP{ p̷dWe:=V &0mIC+MWlH:%c\Dh'fW Zn"$swiIBRLsEldZ&t{XE9KDVEj\!os`l#<%`nUW:8єVD˪E=0oJTSm֕< WR$bz$u,Ki Ql:H&E⟈vz;Q†uވRY=j/ >C+r;Ƕϕ`NPw^Rk8KwSu7ةL5G;Ihcjq#W,9P}7}*j3k}:mv9D]_+''m.pʵ9k--I to"#i성ҝ'7cn LfK˛b6,*]7g$9!Bu;2# &4%.㍼2NPwԑ |%FVl= ygZNGN)6Q8-soUc_,r1e 1'{ v/ dTV9ۺ\z/uq >'XcLルҽ< ҼAD `ABD@[3[\TXONv hFUBį 68kBذ$-,*A,('uq BhAZ#Qc#5h{Tvg9DScN9P'ktlUI XF,ؠ x2Bdlk9xjF1I>c)lMib'hjK,gEΣa9EL\#g9OTvmn8ueeu{!a/ Σz>i"~'Y/qYJylO/W2SrNпz [FZ9+4wHԗ ibJ;Btqt,e~zwh蚘_f<hhg/y%rKB^m[2jk=hNwedyEev5X9B+hyTY#C%t*ݲ (.!⣞[U]?^RT$NJ5$J֥2]ÝTqa*v[뤴zHՄ~Λ+w8qڦ:◸ٴL^vЎ=w8-f_K_)p;7oh:ƒӪ7 r#!m])5}]뢍8l *rw-8gpНάJG)t .:ez^/N;\ʤYtDM;qvV=>VACd(CM8w \aX$e4ӥԽ<&+Z؇Mr=KGEڼ&K/K'f=lBm ?MՆs8;Tl ( ӽ( ӠւQa-0 TC>E"rC0A V,(1*l1!amaCVkQFìMuHbU((25b qFpؗF5c*&Xh4d *yWeEr8TA7 B }Pn E:EԼ>$ȢIR7E6=Խ^#$A} smT4sS?%y  \df{; ՘fWtQЏ t!#!ŔrB,Jdb3DIIwLUak4ouƎr :$qcK6XG`xCjMRY}lttB]|JNj]esFΐN{8k~c L$Ωd(F=d"Ce 9+ q-wKy]+4-pVVmT_1 mS`bÁ.1QIMDW 僽jʒjznl2"_FJ~(,쾕:g/.=b_ҏ풎W~|#&U:r|Il2)zZ[A[AIUwnavm"KVV;HIT '-qn}>^ZQP\~f$QxXF _W=9p;* / QՎ`tNSoBX~ɽ!yP.9Nk_-Xhvԁ[*Me#(tRv{Ib׏v>;"v,zMU/m!mV9SMi=;z=ϩhkqڄz_AJ*}BJs<;Y+zC}|OlLX{zZer*Σ]r71vHr4\4{BJRc9;duw d$~t,1+oaĬ N9r.vv+jYΓ DD(6QSVe^/ 関N*j̜F(O?a4<.'3->d,Vߓ[3e4N,[S-$9 Z @ ԽClo: XQƌ6 ,Ԅh}z0((Ȁ($z6B!&ha[2 1K 9H:¤(lh h#A(ɠQ`QDHrB-1X[=HP#0b (@Q\k*kCG@F zE!m`Z 8.qmt5j9 {Y  ȅCaN_,[wʗ/Ub*WO򐱍ևl-+Ճ!*r(wogo'AX`ւZ ` k)M7"XI-Z;ǵgۼQ".ڜe+ )6blNR>~X'`~ӛ6Ry!:&2 {` 4䂜FvݝT0S%ŗD^!\t4sӷ Hx 8ac^ e%.%;Zb63<[H_FM؜Thir$=q" 6S!݋ J:b p@r@ akljڜN 21s J#ڕ%v#<_hdLF:UtZ#h9n9l+JwQsBDi XGMDVxHsHz`Q,9D@q"DlXj"9ƛQ SWnj؜e%y3Jj;y~腃gny2[E{4hԺ) rK}NC'a'`tGl?q6_K]'5ȝ1*g9˜~IE764wKjo9Rן 3,MHUXpW5yDyM-!ךVTQOKV%"XrЗ\jk|^_̪w,j/aױ 6^p8BPT+iؒXV}.zB=ITB[6x*y7-+ >Zr94劌9(k/#Y咚'+cjVѽ9 <ֵWnzc= ŬM\Δ-{[s ʤkr;~NJ.GuȮݻuErnVJ1yyNH:j~鹮-"*r8J-|MD4st2 5/2o +5]7"u lلeG*73S p"d:a]\Цhu!L&zyrPRlEJ:ߚ/Nu23gzק}&r:QO3GEO$sV((EFp׼)zNϝw-uZ*'.Z9g^|0-lMCĘMsry^迕4mM 㑑R=ĉ%*oC|G_<az=P)_UXuo̷G=(s5%+,%WvQ}R/^h;N1czJHd""Zq6iXf嚄){,Jo%w?itupu&V(+ͨ)ӆ{}U~b4e:~r2&"^rK}EV#0|/(6eZc>3|E}GB ge|] ܮM upձ.NҲTz^Q)GG8d^d娣vldӿl є,QO):Q|U5ev%Q/~⎜tE-ڔG YOrc"ݡf{8ԅ:dՀ" 2z-3텧Ԍ9~>so;4' vG/ȗ{%FnCv"V֣&%r-H@to+ ~Ӯ@Cڸ*UP9(o2:Ycp/+-S9uGFvVfZ53UbML.`Ӥ:UFˢ܋>nN$GZ\Z WUKt2pWHE ^#=[+C,9@DJ7:•c^N5[jUq< *ȩ aRb#j.˸|*eh;NGHaG{ ѣ#e%wέe '*׸FS]GN,i]ZS1KaaDSiʧ--DQ(8*]+1SMg@z.#%6 Jǭ7@6:ܐwXM!8 su{StHa:{UXKҒZGӓTa(aijZAzXD^*'_w&1Ӄ{£vk"39Sr}Zz%׼擙&χ$Tą % ^Z{m"qs6#=u1:ƕzxm+gHRz$C\ݽ ϪQZy.9vVN9 7m.H <$Vi(YYdKhN.-B c*J^!c *U)]"}b^.{\$.*tS['Mr7J8=VH8ȳ4hƥޢҧRMEeQ\*nao`wxڀU%$L&ID h^s׿YG~c@f:ib!n:z5j sz=..Y45z]#h.lXrɧI^M%ͻxKH''dfUWy6~T\ NjƿNb+hU~NUۻΰ÷z!W;Y8q#Mpv ݠEZ ˩'5She*UqM-=fFPn_LZhk:czQ)=g+w-_4z: wZbXɎ]L-- P'ր@@ d1pA@ (  (0nl.6q[qcXᬨA%KUݿ?22 k$0Evj#cN#IVB$ \[ &^ľ?Siuqѕ3TO%f[:{UDk)x2h[9"|ݒα#idvBJ  g $Eq -"ĹhG [ *CQl(,>q2AUD,V* t}7'ҍ:1tڳwb`7 Lѝ"tW"Np0Q%%vE)Eխ+]Q:ke}Xz!<+IYXv*[mSl'exnN|֬M^d8YOkt1҅$2X"r+/x:Ч諾lU*WZLbNDx_u:}sQrvGXQkq[qti2kMuBB>0LD䡛Q,ua]6GF'XÔB#VQY gfr:u#-wXn z^0Pj:VY jث|qg=QN&E܏VkCO&\sBӍZVce+,E*hʬi&\𱨵En|ųYZWr?FI_sQnVvb}nT䢻+rMRZS{1}LaSr⸭WyXF6)ro9$g 뻭,D2; [S96)j'th7;wޜgU䫖4z ]g%䜺*!(TGG0uk3/bjJ*EhkCaATrՖTz'G|寳b`Ξ1]L Ee0A@(P@ րۀ 61cA(Q@D` q.#b b\ Tn%z-@46PADXj;.td̼AvGZ,[*QqH`fYFD5tQ⣚E(iZtd_otڿya~R p^iP [\VQ|̔4MI* 8Ԇ668Rz# O70 /& އHC$uX@&-E} ](KsՐ4fFҰ$qD.}-)xߢPm;>3rqwV/_:cQZgl6Ls*Րkp'9OzΩنU!W}Z#թb؇*PP;Shro~'LDa:ե 3jA*.1jR"JvhŴbN[BS=u#WJ9QQZ4l!xj*bM5ޝُ9\>G6QרV -Z>J͢=Mp&UY&9 zn9!RK0cV (eZʒ~E}ZҨ Mk֒-9si||r P -GZJ]A}9+!]og.o754 |W "ʕ 'խwu-QCpϓ:Gx$O.қ\7Ѓ<\9F]Lj^uSv>ρ!QMj TC7"LpsU)rٹKew͈:J) 8(F: tvHFtQ}Ǿ J)_^ϼecSixU;pT#;8*ch*c$(Nj-hѝMm0_Bƞ w]:qG{Ftڱ;#Ȥj~Bk[hsB*wa6G]%jf)o&W:kknG:7=Tf-(s''4^^ȧ)xO2嶶*0O-U\>YZ!%rߤ0mUdke# Ujz]߫m9&pnMsOGR9?MZ)%+cѾl#gR/[,E :p4ǧcS*Hd- Q q 1`(2 @@Kθۅ ĸ liR&@@[KXKЗ9@AD2uG|:Ԏn⣕[6l$*;^[9.#2ٔu]IwؠF&K^\9| o8r7zWHi$O#S5!&YwGKRV{2Mt6Սjj7+w+k$!V] WiиYGa4gmB * d TmRuj@ 0#~"dVa-[ ܔhS{ bMIqX%)5P*\ǠrSMJ9D b Eb}hّb~OB`L;\)Pҷ;B6I"jG)af8Z7)j,B#SoȑNb(|I+AZr)EY R4ZWRW;U1)1kW{rc%xC[D \|Rh .,DN7;! >|Δa!ORPWaHY45NDE!Zsą9H$00YY/*ě5*Br݇G\T.GxD21?5 B.ے)ғko S|_s^,ܧtCM$Nm8RZy/EUo xHaxЇzDiFQ:XaܐFFDs:9`FD=PkVwQؕK *xrٌCoKkO_-1:(Dã2sDLO[]JS_E\rlZ4C KE6wiX9fv9VpHTG;Tw'5Ũ-'=Uc{Nq&Xa&, >P؎xj}W(gv%SEd6+;$JQsgU^!lJER&FvR3)vF =9a nbTrpt=EF9G&`;ęF]^Bؒ]q\#'åj4ZˑWy1Ѭ9ֺ9F`2Ui-4}\E:rW(=QZ%9i_=ت*E6fl@Qw%iwmw]X}.GZN0v̮1m=IŀsЂ/$XP=_.qR)- 4.e*1:sgr ! WK^p8s·:8HJt> tf,՝BI@%szu 5Te*9x,h.>lr/ɣޚc1kL H[Qnfnl F)W=֒sZ֣'7|+K 9PV섕X:8ԧ&%# sR(M{inSTYrmyy 0 @ @ aҀI0AD .(ELɊ5 g#q-@@A 0P@PPpH DP %G+@9xDl|c׿9e!m6^tMVRj_忨.qG8B0UtJå%M]脋RWfbA {Q!]!QlWf }/%fqD ̩8ڄ< $jp*%>>j L{_!ip 0s'&ΒԼ@:.j'X}>vmrFgڐ&ZkkR^C%(/ez?b:vȭz^%+'8Z%0M~Q`+ACL̪" AtHi*.J8]yVT4-:1m-9 &_G\v\OT9#9)4.;RهVƅPA0*KSgt ɶ* @pRĻ9BrV tr+ w! EeWJ,RlmKWp,]Z-p JNjl9+`[WEwOއe IK8 Ҥx,`' 2!Y2qMې"y-?F6tΩ3WNj dWNkÂ:ӯ*rnsqo,|ؤùLУ OR^QIOG9E#FGz$ŭEY.\E SajYjFjZc-X6gd**VDtnuCwgJ4RݒhJlF+'f;_w>ld!Fۻ7XįE$w{{"<-nM w@[[q;ՕD$֤`uZ:Qö!|6]Y!w QCc2XZUD9n8b\tK5W{Xw]MNK8d1{fBut @B:sI:|ZN8_3&gEkAJ!W},o-N([V[!ҥHWlHJrX\M77EO%s6>kGMEf\|רJEۇ#%C Z[$lpu.Ww6=GPCF`M::rgՏpJ k [İg9+Q[0w;vfׁ(-rR>eegH;JL#k%_J%N6BFX!Yw\;qΖǠJ}V$G "c*Fv'9v%5MGs]׈,eRa.K3̅D:Ĝ"Op[^y=O]w@@P@P@@]JzN^P[ N3翊8pdZ>=JmSMW8E`(  B @@ [0 Q( Q@v9R7Ot΄\bmi!QKYks.a"OGt(zv͝T\rڂVI P_pTK_Q-#"}HݪeSw.5w!hQrLք`2| @+  >7ZrſW$|EVELue+Ml+C/Z8XU3U&8\vuLmlFun^ɷq8(+a}EaЍ/ iw ۓ,T&SR%=(\Et7~%K؁bjt|%SPW{!$E}{Q8IYu9ހݎ5e'\=|ʲjoFn[p$’r)TmXbVqtgX8zv9HVwXQ݌S,{57Ѧ׆i&\ 0v֭#B-jWf:E<_z9UVLDSH<]yWdI,v]Ti۸hW8BlԧÒ*]NЧ&6#{{IPb折^)-I$KnHʑ %Yue~3,dE=1cPm%u}S99UyU"I$uwҝ5M Zhw-Ө$k-7W3zrPX5故L*ivk~CVWC#r)O;f0#ܟU2}a5- ބ42*fæjI`$2XWetSZRgLLsAa}*mfZ$0J]D,$ᝪ.LJlg`u9 ];9S(^qu)juhGK8^~$"@(E@A@`MOUOU}y@ ([ FDQAGB9ZsnR*ci󝣚ˇuyu׋xK7wc[i2袣e6FVU'"%Ũ_9c!s(cL$rPl gh:(ةlӱD ]ȓ JZF={Dp8lt@Т6I  .%zG>ǚ+7R! - ^|Qixv^YOKqP:a 05 qkVvRՀKE~S 3˗ )/)xS#^OaڜmF>,,=/b25rckڱNG6/# Z.Zj2p 6G|)+ #E:rgxM% zU"TZf)2/* F:]\T%McjTJZ4M^4K fHUπJEt/ ɜ&֬J]:èjG*ڊHZwYM)a$W#f:R&%./J^cWJw)cvMo\nUͭW܆bFmxŐ%E鵬VKRl~rsI]zG kZYݜȔ;&EeA9NJ5y\ _h"J`I\qPxw5&D|]!)F-&*b[IqG'%Θy:"ݑ:A8S_8%&a#jeh"ctqd&[sUuIP\,,US%mTBJG>ZzNDSPVBͥEC^"Ԫ';lG$ۅ\y;D:TzhSRMq^4R]8Viu8LxT׮K) uR{YehENZ-ĊtÕMdI{P,+Mqv1;[Fsp}j-(E&I拋{#xw|D+tqδ 8KR/TV{G(5^C90P@=|m,2=y-Y v~ϼ[mhGdy_uXukFf%`@PP(p(- 8 (-( k96D*Z+q޲r;F<eQ4j#{^5kbܴ3nI2%JҚ |SQ&8krwf#i#LXl:F6:“ĨPQepH)aJ0:U,޾~GM8Aఁ. n4Q""-;vAv'+ğ2O2*xJg<ғ& wHi6½F39 F4D H 3L W>2g?I'C1 ч{Q1~$4Erl]2Jz;DUQiOqB96kvq5P-ERA=EbQֈ-R{3Dtō,ìkb- 9{"bvHHPZ0_'Y1iQT{݉Bݝ[ʮiO7m)wq!rĻ/D+e}\JsN'h'/{):F,-U߳K[Y:qŤi+;BEѝynN]=Ygt$s:(MxjwqNɻZx@l$U,*MAj25Q&#jqGw| e@85t7&ejO$78,C&w1Xدw M7峜"k=TZrғNu*JVz 5##8Md6fUwDZqڰp~uM NHJfHrTމ QP]ȁ0]厑"!Kg$bQrfu+Bk,^c*auGE!U98ԠØjWጧX~Ka!m׷+ډ_^}mau.+lG@%nVxi  nI#S*?[/] mf-jK/`%Ph6AP-FXM;SuGk+p)0쫖ѴURmJ(WZ_rn)v%CHR,.J]̒f^!Cᔇ=.؅Ujm=NqKI1; &Ql N(yՏb PA@@( @9WS+ۻvTb]mklZbUݻ)}1*<ԩ^*NQ.U+tp[jѿJx q|@YoM7&ҧ%JJf3(Q` (EQe| /Ix1@AD {Ϣ׿4])z\NRE(>=Ba+Ɨ$erӤbNqJ-_R$s"gNnkv5'!@YXĽh!MDIAG}X<,vjہi$GLaſ-R_"[EyalP6~1 .+ϙhcۂM4wbZ(s! H[X,#v#d22Ϩ09eq#&HǼW#EXER%Ԭ2>%0U)3 u*5r`O>C6uSK~g=_NFyFĉ.ň,Yݤ#q~,d-iS~>k3VO-!T3-1X/(+dvȏKF Xo965n\=KB1s"]I^ s;.WރUv/0VPGbaj{iO֧VӐ7es*VI8eo/N(BQE3P*ۋqWko`XF6A$UJJ w'r22o/- :eӛ6:rr٧lP#>ՕrV~[?W?q6CqdcI1-١F]X2+ZXՍ4p&yKn9SX}l|X5 ~rjCJD,ȏ`{Jy,-;grcd25C Tn:0#ga֍~cHY5L57'GZ4}l'qaZrzʽ۷SOwn¶ Ys;7x-+ttghu9/&9-+dV&8MyNWGx?S ;];潹ΑjVg9R!KO5'-u,'jv7-,(7{v K*V\E<ȴ_AJ(EB*shc_&k\Sǥ*~wKEXg*<bҔ%ů>X%7_vjUFnRng5m&U䏬FţER]<^)a\RP(՛wٖ}$,:>25eE|S+Sj%ֵ Ylޞ+NjB]L^)N(gNW4{Jُ jii$ּt&"} tF1h7kxrܹ$vELeM2: M7nM2Qi;umiK1ޜLVO W+n\#J\oՎVZIkISwFm)y;9JuqQmugrVs$NhМ7#[WEEo+Yw.v芽!%)i{} C%hywN6pu#=(i{w5IIOP0( MIf=o&/3 CbSeqDumēscf: R*V|cW9+qFJ?IxqjOu/ -t)p]XpwODERޜ]UZ -$%܉?]a :^.V?7[^9ZTi;%̧ZSdwe}Z}')nwd9r9n>42՛w!֜4ghT Nma: yDirQ|•LO"hz6<`OӾ*8b/*=6O/іlj$ZēF[/_p2  @`PgnjoͿx8T`Jjl&gHھKces4gU2xӏ$BVUwے3iU1J:-_9:Q rNAM -Hrlm04ЂvH0`fqD:XUM/SKOE贱`*1-R[K%'y;[+b=ڭ'Uzq8K/$iWmA56A]ͱV1@l-t,*V䢮ȵris#6ޭ&mW@UUF4\_*j?՗$cs]ېj$R8\6QD[eB$80 |e[T!qĂob^\"&I.^;Šc w(Z"Ht-\'ViH}~IB2+ᯭPZ ]/~*˳As!HQv Kz봟ُv/%9!6cKqmey}-MIr:zp:ѡ ]q߈M|LHE=R1u8NpT}:ӥcNSmQm?HzJ%ݿa2W89hWn OM}%U\z2f?׼Q)6wV)%[/9Jjo- MRYы~Y]ݴB'S/Q%,"V꼱ۉ<꒖!m- V:VMz j+ _{G-KNϺ 0XE[\ҩo9Ќf{ eLV燧4\;=Wm:jT8Û\ejWU3֗]Wa%קnS=[}|nWIטnP{$QFԞKvRn쓊|[;z;lVO(ȃUK%EkzX<1ppwXyԶ^inwڜWoqӤz6GK2_LzO,/_;_N2jkrR|[^X|XED8 OPd\<Ɣ0Wȟ(G+Eiʑkb]N[tWYD-_C2|mrYp '9qKZF0ć/1ڜ}E/>ǴەII.| 7G>߳3BsO˾a쾌?c-}x2 ( 1zї[.N`=0ll3: @\QC@HPRO@ ^1JQ8cVaI%TҤym-S_;/ӀSV :,L{'[XW>:Ҥ^s,u|{Q/PI^;VgL,fτ*YzP SkVvǴpctjۜY<ûT.=x jՍ擲lWN=>~p6*օN˼tO~?rwԇRz!Ylt n,Š!huaEk!b1Si[Dci5{hGnguEvrATQAYE.[ Vî23˓#'%qB" AR ˪bH"q X]'l^sR e/NÆ)$+ \ -M_S7tz3= /:~䣍g J#qL/:Wڗ|Nka'ؘ^DH,8KLG$u.9S{ } b2%Q$RY[]c5yw9|Id* F W-P͵a Mnl@YRY2D=!N2,̔"Iry#.L)TrQWQM'JfZ= u4M}%y7qjz\q,4բ:Э]¯/~f(]6+5~B銑SU=yӤWߖE5$b;2+ZɢNnn,(+ F M\/My/ylp7I.rW^N9"ǥҎ"hVVӥIY\k~F*6HT[t j-+r5- ^q7]SwW}\>8 Rdv%W(p%jZOW/jS-]*Яi0p2[.j;.Jzrkgp\Fi겳%r-1+d<4S]VlXdTܳe͑kuH̓>IJQig sޓț5DԛoV2^t,HW4R\J椖tozn֊۵Z 8UcwjJ|艗Ts~&ov^ CA;pm- TOO3q +mzJ"[NSe7KVhIv*GA;ԫ}Om8WNwMޝ/]Ì|I喫Զ~j9ҭ׵歹DPC[Z :CML'a[;sTj Z(Qְ`XpԒz0H N;(Ww1pҏ~r>芬f|k7kҒ|CsBq$4'ʺ^7*O^- Qw/y-N8gxK|g<*qd=+Sx߈$s){Y##'dֶCqԠ (/LȼziҬ(ڵcB.RvKG I8_z{6*Յy4{C!G%(kbY&MzIeL\,m߼:G-([jn⨎Q1GZp;Fъ$S\X崘GS :I-U1عT˅\\)\HNz-q\5mqCI^rXռF`F23ǽjGYƯIdYBv~L<pDˆ(QUpE 0*P@ِ Rm}\Kg\:rnJq%e'e|\^[zšZKs=7|#N6՜jb:*JnG7nzFW4>4u#Y/E_LKfF rZ-/rԨ&\?8!%BCt*]v󔸬|/^-[ܦO2vرB#6 %dEq;dV[ ´x%7Qd9'-ŠO kMm mĞ&XҨӒ96`nձ2r8ͧQsܐpQTն$aVadw;X*ChNg"bㆅya%rEK>$۔2 AF #b8(*j4茞v'w/!zI̼xy)Z$#˅5$Vq,ba@h P7*ɑ&Y_wkQ^7ishq{X &~tQǁ־_G4*Äz^1Ε&>[2CXo"!Mv~DdiBmxMuTruO=ոquc&u^2u{-fdrDzltDFVHΔ*jHWZ 3X)J:T:JbWVR']bcX6Kڊv׸G+w|2[rH|:8ujN 3 *\) wDToAFY[Kk-dR\ ̥ᡴan咳':km_[ڽ{ D#,&3}D~4ܞ̼a2TK};*:rvC0Bͭ1X^nf VWD:2WDaܷKRDMjênzJܤ"4Xz5RZ{ o!IZӓIG&_oɩ>!HƖΧn;xxW֧Jr-R׷cp,ƌ<_pFRYsDz]LJR] FnbvCw #?^N˪.5ZMd|Se'YaF/nh[\Z;'>dݗpJ =ArؓQ?qU! $ܭ z, ptiG5ˉdfΊ_-ةd;\=hS[rJSrkwkhYKR:Δ֣.s7wͻ; ";B7M96SocpΥ/Q4c'HFA贬K~AaVV+ŖD/z hrL$Ҥ8fH/Ay|4Ú̄@9U~lqg~':hES7;^iYR+IwqxJ񦬾m&6)$ݹI M8_geVY|Rl=#|L;ɶ8JMgm4r:rqafc*y9Ӎh=SQLVG _uhz=\,rtZ[h n^&*Iݒ]dY=IycwHqBhXp4PֽD4fP`iq#gzT %jK#Պ<%0i R>n᷇$l#j\P  F P '.͊݇5>s;mRi1Ӓ䄝XFrVg.$Zn1܎[ \\0l Gxӱsۄ)ؑbMQ쥻%|FW3stW|YGIվ1QZ5W23iIpz*;!T23ΓGD06{l݉S9!T_Gs\B&`y ?M2CzEڌ2AA"fj5ДP6!6 -Ɖ{} x25$KK®Qɝ*W֢1-#HM4}m9>?% B+E SY2%o~>JJ}âUcm XK9 ΤtG,|9t (EE:9|,O1~F!GI"d?Z9y7^xXaRDތPO.X_zPo '*}5k%Dt\ֿq]ZTekJWw|imlD()C3\oخ֖t𲖯E 52Q/]Rqw6h)Q-yGO= Ѵ/Abdm$|wIOTO#M쭯bϠѷ՗$gھJ0;kmOY(M;߉ y+^m"v\62!(%,/\Xy7Jf _qC;Pu04nwI.w~reeLh5ptmnavxO*0MpIj%WFr-^ݩnK{25c]䎭 j.]e{kȽGbyt$E8m?v*oFKIJJWRW2=J'ܞi`֒bww?ӡ*LjW/.*+k¹]RI7Zw\z=z} 3pON"Vr}ڳI $#\Lɸ/I"~GJ4oÇu)q:*ðQ6*#Tz]%򤒊Ec09qW ''|7HRꭳSJ6F{W,1˙SR)e\Ʌ> 2'{wCI4@*ܜv^HB".s:b4-S Jq7q,,.T-% {cwQسͩYkYGq~(u)v#7ڥ/@nas"pn*6=9I_z9x'/F_z;Uy&=}hR/ LStH2_&+WBlOKTêȗQq(b=^7Ed5o86+vfXrC H@j>(Fj+XDdɔh## KVMn"hӱHp swa,K,]:Ҩw9MeewXY=NS#R4M>IܗSֻ,#l+4rV(:8b{)M9,8l+ZPm\F׼5v_Fd PJ ix t߭#%4ٜkQ}T8KUāP kk'4"}m4PW޾ [)DzEscO:i[g*E!nw"JKHrwc\ W!7h -iqKfӢvȡ\J*|R:UPvS)=Lu\u "Քޙ}"(cvՋXΘ<1+!ʤF.OAhR=XaEh=NgufqˠEj-ŒgFEVKVGxIi+̋Qݰ9J?IY vvӥŏ4}9F-"DhwVKN<X]$Ʈ2˳lj &G͕ITVaf4(׃r :me[YvT1Ҍ)+laXErg<|tXߒ:*hy/oYPP"F* ¹X%tUl*hYSo:A} ' <^(Nғ^p I'I~+ꊭ&dH"IݑDtRr@@F+53W u xZVGn:/qÍU~}FewȽҲG4@I% GZdsrQ2kU/c9+^4inj2u. BX@*un-f߬m1V(4(@pl p `%!B DXʹቩMZ.˕RS)cJi;;[hg(yq[ 5 ՗9Hߊf/%>-A|yn]o9:W(Ԛj>>oM7"QץE ^߹zrvT#KRZhV#FrO~Qj4L]Wm'&яWi%˿ F[Yj~jƥa#ZoQּ6'y&'sH½X-7o w\~ D>qQv|5UD=8Ew?E1ە/ !L!sR&Zh| 5؝f9C@h}=:IZ",6rr67LVD7+ Ż. $.pcӣaR8OE?Ƴey .!Wz8b̷Eu /)UcuRj.Gl@h٢#@v]. мrwFѢȁa@#W"F>Î"6Yˈ5Q]+Y U"סWydSs2(  ܎ѧmrT];F˒F~\H.#;"Ԗ"λ%d7;ٺ•aIwcW;ӡ)w:ti[N,HN4O')\}E~3gKqW|_1\R;1U1[jD^UtcahuQ5C; \Y[g%V:1;-1Z w:unBmVHQjKm[)nErhG)Mh#MFKQ2u/T3a [訨#LexWδhjxZ+JRUݱ,HzrQνMҾ)v;MJSV;(Frա:tz#;QM,<'dPFWRkmcgwjؖQ$ׯ"b(ʌT^#&KV(KO_R<=iEULUvӏ*ӃzWkN,2{]ufI; Uo{{ -',eklg}1G<ٯ{Bzm7H\q٨QN\YJb˞{rZ~ Sc]Ǻ)l֛aPJA6:9HG 59qcc),u -=j& U\ ` MAv-:5vX\i5qBM]@8VӺ:ٚ'Ca(Jqzzl"Q[Iúfы -+N5RWDn fS8X,m)T{>01,K?l.E~gѽ)ZU+Z3:p`(0@2Z)<}NRzQ+Qurm%fOA& ^+$ ]|rvbs:ByՑGgK֝(Ցhrrs"uZ(IہSҼ1J!S!A. ]US~| ZV*sm~6cI(iq#Ve&ߓ5Qf"ޙVhɽ6N!{>IewZN w r^? ck9:&wΎ6g&DL$~Q^{Jj?%ҧA_JRQVN˽j_T$ۺ~S2丧4˶(zҟYWHΕx߽wcW{6un.Q|*9dbe'R)pRk\,xsMςݿ8ZSTZ{q9zR)-FV;4O4w"n:W#Rg5k%Ku& i2MNLY)J7nҷΗӦe]K~$f2U0SMolղ],&M-:fEQI)WvyH;XYuյ{Dnތ*㲙jU*{ڲV5OC!jkt3^z2 $](!l6ymh Et]ET9IB66u.Bɀ6׀dkd0u8(TnuS۩C'x?,z-ksFgZRc,e*(gMTN/f;&PaX{ўPxi~L2.\w&ee}^n*uS>٥ ҹcQU*-Ƭ龌N9+ѕ 2)_FTŭɹhxvoZoYCO"Di}{JTpIr5:O:{i;eQS:jSr؍yrճ,)!@$G&0bU:[2CI2#SɻͲ6'4Lطg{q 6Ζ9PJ]}#׸-,MEj6-Jo;Zk~V|w.c!ZI+l.:Gq[Wq[ 3za; \. y+GtRR8=$L$H[RH)+.zQݯH(uƠȷ#8P\n+#WGzrU4Jy؃e%Uf^!5%[qh;.yeT}"UIv_S%'R^^QzЌ$ DİE-lI-Npvd]wa6*R-@(@A@Qj* USWg ]'Zv\QV}cX`].^.xZ+W,rӓմ\F5;]Tk1Y^2&}Kʟz"EE8)Y]sԇɤX:& F\v2jI4Z*++^OIҩ9fmm#'lkUf] (ihMj1JL[,:N8Nzգםˣ1VVj_y] jQزtU78j-]ϙԯx髸Twmh=!Fc\<Ľ$ҡԬH)(^~*uTu~"Ut[>բCrV4jJk2wO"3꯳`1ɸ)~M i*T\tւ}i ,J4{oL5?udcτ4fP@UU=%%㢂mR^,\'Jȉ6:ظ&G5gG̊۴57xEvOĚVDB g԰RYQ[rUKCwþYd)hͫ>L,Ʈ|G$c%uܡNH __g ,QǚdF .j^nq7 wusL{ >nr '|ZJ7{ހLI Ϧ#j\0h ,  Nm_a jJTˎd0X,Ѱ _B)>{[$.M )zg%ˢKe _Oי/5 ~FMiX.Fz?㣮[K4 ٳ#EI%/{FK} Uo5vF]> b:6]7=\8J/.(ZEV+tP-Uɘ~JiJ?Բץ.1oTi2EKy?ӕWctRTVJfr,֢#;J`(䣫vBFjwl7r96M(:F"NhrTE-q^Fpr]GZ"-38qn:Y~5]$S%'6ZGEdJ :7o#h~A,ͿIai/=3&'E#3VUR[?Ft\+洭DPynf5 N?^KE &?XQw(%BC$Gz0uSsj uMxb:O!Y}F6B8Q9*un9/D([&S莎l5ݾ$)T#κSW`ڦEwU!rut[:Œ;uߑ\M %5h/Y•iTvI:#\ltFmZʗ" I9:q\GFRMWm{q9"e~IY5REa˷D+v(R'ఒ>QLtm:SߑS(}q-%:`+{4-p$ -'t(q~%dLo/Tt.݆:r(;KA7e7d.W|2 KA+FRwF+"wb^ ?s{t6ŜεZs;#sz2uM#/D4,%+sF<k+EZ%Tiőb86; y*461#:"IZu2ۼY@];$n&k; 80+=.I:V{Y{[  X݉"UaZ@rD*(^#qܗZ'n\:68%SJ:Nųӕ<4Y5F k.6#Ye{$U cm9 S{F7 p_;w:W_M[pX e.m ޫIx׻ɊSn2VG ~E%_YMͽw9{?T/hScLv1=^r1Yn$I*$ڧXՆ`єGvvD;IMa'dGkWel%XΩ'6,!sPd %wc;"t2VdXS&ЅX'x9w4|t0t\L{߽YyЎݪxvd{"Vb4K-HwL'+Ro!NrO3OyAc%M҃* ɲ`@P@B 5_uSU ⢸M86 َ\SB 'M?-V얲{/ӁC8WJt}y+^S󦫠wrhVyGoU' s=%}18[8g⟄:/c@ZKK1j)?[Wz7UEPWVԓurTЍL~kh߁I.a|8¬k6R"&]EXIY-~]PnrK9[ԓJIڳM>D5QJ50;-Kx3Y=dU4M.g>=Ny!]$Σ4n.1 $ut/QҔ.=;BcTFԫEAJ\ݬŨ-fwޒ-{^J.Z425>(`'' \2VRIx5))ejRn&hJ^nk]ULc[$`߻+ڜc&MBUU&hR| aOY?RG r{rButyۗ4\.p \EۂGH9QN/vf=\N' SjI;[q"ՋrMI1a(r  .h8~*&tVuЩņiAr_Nբ$T Gds*`ԬV2]f>Ay-ewXx|PKʼn&,n^,kFmYv_:z/aNKVwgoq^MV7M!z~2^^gLJv .6Æc7v6z!*؋Su"v Rɿ_PEK 9ҭ6ںTRJ)KH]G^)># t`9d¦H*F [Uq8Sg,k3O0r/i%kjK^=S.'ggNPXj/QUg*| uM߁qs+rG93Ԭ,9F6r_VҦY\),Zb%BL:epg%vʜM>e4AF̀@F:K-%b+w;ʛ#ð7HގnCG+Fisqѝ'6I[Y;ߔV =.M勾~i`akV;M<\BՒ*}R׾,BS%ni6E| ؓ'ПͯM8+c^Y]̭pS@s"Wq~Dp%Mq*4zDkK.'%'xA-x;\'&]܎rvKi;4,dލ4gYћps(0X  Հ:j#?$Uy=| Jfh^w%\zܬ՗([qN%9uVKI&,TWFJ:QWVzcf|]\w"Tos`'=\geSEot Υ(Z8)%S÷%CI%: PåGCڂf+33-q'J-nFO#ϚwF";sIQFSlLӘ&ċ\>%CȰS/NknH84OWȗu1ҖyCR}Z6DR< hRkR4؋O )''tp<8=2]G܇>tl;Ү(pޖ|S{p*16,Ul8BmiS)8:9l׬tTlaөˑӯ\wb[yVCBRծ"b>lWsYlrMR[܄xITӑ&*{=jY[Z]X L3ˡk4(VKā jQ*uzqsP]d9cYPM_aIiW˖q/+EipK+E7&k-I-K|ZOO(`jՎhsFx{)+7~/HuL|pNi5%=S\Q\.MGVȹxcF"١aV6ݽa0 nY)DP ,> ˃B6v3Q5rW[.'S}0~\7iW.d{.Vcs+v@ Pʡ@{dtI*k(u|//w"W 'tPݴ@@ĕaW R>!x0aHEHQ؁U/u NR7W礿MsYpf6kGz윩׊E!߉htzmЁ brI !5ՎJC2\KSb<4א@TIW\mzRIk`;z>5q 0I9ܮԹo.cr\pu)ʕkIY[oĘE8%(lhB(@动ӔvHP|cT ^QOEMAZڲl*+ա ҇[V).(^sdCۭvav'/ۉqgUpbc8bk|9hxVbh%vVZ>LWHde7e;aeNid;uYdI5̍UyvR8WK2z1;/R.Xu&܈JN-;r/ دE OhOYB)R5i/.OlmYFKmېΕ*2JuU);&_|H8"ƅeYhBRNVx[RV򒷷Ràj]׃U&3t%*rZDzf'tr//y *mgn){niR(z.)MeY/g\a^M^q;b >s#-KkZ~ ~ݡhqe#,]U J8^ kRkVTELKM} Az񰲚,{A}$q2 d WOa]Ego_3kB>'G 'w2ޟvW(TʣdܤT~Y5N6ܾwr}Wb.vI}F~%/{ΙFv49;.[+TphT#GX[Hj\nNR {j ҃+FӒE6.%vHȵDʨ)FҗKBl2$W ϸU^E^{ ~*/Q^,W/z FGkR9 A1Å8X꘱I j閏Oq"6|/}6y??B%Q 5WЏQIF41NN2==q3J+zǕӖ!8W6-Z=gEtlS[YR| DZƻ^ze_KP>&xfoשe-[%yC֤kÒVjrz$-I&މjoH->jSMU^~,5rStRy/^fƧ_TrUOcp`nȓr{$czOILz*[WGo_,k㶇j=c{iO_lu_1g9Pte[4}÷j{ #\ETֲӜ'jkkhjI+'I)E'{K􃌪RR^5Eť/U Y lsQs:5ɴ͎-ߨz0JbOW ɥG!e{1KW*7l6S<5=漄Keu0Xi4¶~ Zj,rv.]?8,5\ecU۴W"8,w R&7 Stޛb2dzu0YӔkqu^=yNxIYaB;َ6׉FKEUJJd9˪ Ҏm8QS] +m6*Y:AiNxμޗ޵DnD}ganĉR$ÝźQ(寫[yV?hj(u|mB4ׁ ׇ2*l|]n> Q2SSH^lN>PJ+dڊ+דڴe[-gP]CrTʫ1ZMO}jw~,Zp[w*Tv-&Ee!%c;mɭYlڜh%wJF^*5Oi[6 11VwCFAuUE;SyQVZ|LdISW pTՇCS.^z>>iY[;[B3 h)wi(iЕG+3UYtU#-3R{&2 QqRڎ{|?QWK7'!:Rw2jJZhpXE.gr]Yy-( pF.p-F\L8f"ңCO35y35Ge+1Yn$P7b7peW F #8f̷#.Qc{ ^"8LjEZjW-R. 1GLF0]4s2#/P-*ý!UZpnU7ؑ]+;EZPxai׈Ǜ2E{XbHp^(Y^/׊OouĮܼNH@r;1BjZ\v}6]z wA'I Zg䪧 =z  %HU,U)6ߛ2Я,=G8xf\~]!V0n^\/B#jq6]DHP"MZHkQvp @78Lp!/``5tYa4^5ފ;pϣ2Z=s+ 79Я TH;t5f%5M9=0}kERny5=7 ~խīª'U ^,2트.9Mmg-R[\e? (Z>Ue)k~(F|c/yo.k;x)KH-rEu>W:. 0StߥKO~ojz U?/eQ? }}]E V!SW[rn:SI{:zx~s?Go؍J)%DoŖԽUe/:,~5amDɺS}5&ۖ䘺u~gL N9њgelזyƪ]Z5(FE+dTJ2ôӻ]pGGl$]J(VikMʘ([GDSpcڼΟEvWsSJ̍&9em#gW˒$t޲` Whn29 RJ>_ }! aU$8LLS嗲v܏F~\2f[C ٮRkfT3K4wFfGERtK}\؅NDNFv v"_<K.݊{c<; o"9{+I.IhڲOy6/QV+-'>.R\=DNuMŤIxg^)'N.O5i]ey=XmzZu= Kܥare*ĉRxh0`Q$uexŵ8]vWΕ]?Ip.}U" JlQqcqmHKXwUa2pO%"uM UlVQߑҍ.k9ޯcZlVΧHIӆw)Yԓ[%PN6ʽEfB4RV\3W~Vn+KU} 2LGGIԫ ()C;NYgӋˎ^e$l2c_ |Օ4@AD@D:9i ǓƵgqXv2XBwl- p3@$EJ_H;ef?W 'Hj׉,OҏTjQbw9X;՗BR:\J")1Ⲏg*_t.bIV섶`. ZEh.wߋaOʼnaXP6kaa9/=θ%Vp@9Cuv,OVO'r:b#9q:ENX,OM2w;ӻCGX;ӎT-qzh"xܤ\3uthʤ)|zμ!fd|߇!ޑ'uxw/ڱuEDWt6[=Bi)UQDR֝Ky`v?Y e~^'9#tabhө +n%+Ǖ}M\m]rJFԪ+O_O^Js&STu$okcz7 5)۲Z{t[9^7`,O/i[Ѵ%(TWp)G/3kTc9H,>Uk6=> YV+9KS7~ie_xi#~uG] 6ߩaU> 3r+Jl^N}M'|iɯ'1؊/ Rt^_b7HjoO.:Oc)uIƧ(o/'bz䦼1VXhN `ŒJr$ORtii5vۅĬڪRp÷^w57Eх'+WQ^=ۘʘTd܃xW#E,T'J1J2VWڰ̺q&峓Fe|լ,BSюzX*{qd6SC%Vd#89KHX簀YqPQtd=OQoE]@l槛AS5tEzØj'epE]ZhsX];$7\\wOMy0ӏ;q.%OHFOpі} =lrG4NV-qoCIw3p\)Iʋ]w _=<>+1;;&zc XI+J>v%WGV] J⧫N//%cUK8Mוҷ"^=읈Qȕ'RI' /QYIe;b;M\J[piنnh^IR:e{3]^U8u8YV˹WjXWLa$?C*m_U;9EYYvN㯼g^}IͭN*RiEƴrHOA\WenuӖ85Eq˪\c:{fݯ5mFbs(Ee+7;r%:PPT~M })oWޕ%B d8P0Pƌ kh `AD0[5|+ԮrW"]㢭Ԋ䗴nvBQT 3H[Hۃwb+zC\/XWcߣTH4Α) :S_9@qkQ\Ŀ3 NEek1!ָ堍^ /cumnT;9+F ^|k,`6t/^^#xcƾde''޽!C^+Ŵސy*RՀQ$՚Fy2OIw~2^?eٝ,c$:['jN1Fn!a`X^dӛIw _>U4] *MSuP8%ݿt,۞xa/Rݩl4XWm6knqշCg0Q%MЃY<ۗ%J-ŷ\=JSѫyj_sJQ'Wȕ(ƬnU򳾢4,{ľR-t8L:SZi挷OuLCu+J&?8tķto|?UU8T~kFUajJXMo'-:c!ȜRPwR/3yU\[ק*}Bטv12Y`6ijm.:KTcGf.ş%D Sd68JWt9ItFXA]ae^ B 4ԃKl^1QvihbI:  r9C\cJ"1T#B1-Gm Fâ(4]#pN. jv|;+̃/ )Vz'ZT||{h!Dzg(9dH-PZ=3Ysڴ_z:ԍÄZ}K d%jDޓ|XJݟ4 XAX7Ѱ|+IԄR7xQz WQRw(ӗNɧǼ~IeCz`45n"KEzٗTZ./Ñj:z2|{n.Ӎ%- `4@1߄tzS bM•NMs*~b鷳vn$y)sMpiD&{x^)!~Gw\ثyQӍ7KG:K}r"l^֕/񦣠_b/q|.)ЧR iHV+,|N=/e&c9*yh YYEm{y*غX*IEY#MOScxa[>?a\$m~ {Xw*@ -K9v~汙Zpyfс*d PԊzE8=uSkE:V^+b,;2qcjI *#+Fy p`:ƚZ8@JKEuzȱA!:Nr ;4;Ϥ ⟍ yIb TV䚓Wy],i`aNj9TSջD.}ei> ,){yzJY648r˹@mh' >'DitC%rme{TqO>T1AYj$BFHQpyM]:xX_.Jz:6| u5n?pF/fwҿ8'BK{[t6{eMPtVܑ~Pbok }u-=P\''ZT+KڄhbR_F^uSUh9T1_٫yVkIE8T9FZNz,hyKR^gIT)3o^/jis+7B#fJݬEq]?U.J^iXA\FI}(ӫM%O\8+U;})igٻ(jy;qXNYP\4ɻ<1NM;-x94h'zzmz}f%ږY$z:b1˷ ʼcINOpl#ƛ%P¶$ziGJYETjuT"}ؤVgXر%qslK:S}q4A `JŊwUVY"fڛb1y.kJR׹[(!l`Xl8FF[E%q2*v `ͭXGfC%`DR mb.SOxKNGy/,MTXC⭰95+Dk,%bVZ] C՞i_LT#UWH^/|S#UZ>G+H#:y3+ qDpMpi^ V0q^>2ٜzNQH[Cs9]5lǕk)U;0C=H8ׁsk%t(w2>f!^DYˢ梶$J3#7sLzL­W JޔV:kǧFLXZw_~}VE?҇ eKKESp/\l}th\NjqiF p\X(䨛[H2n2W. WQ:2ulD=ɫRJYw{$5ΰMX[.su4[e[׹jEhrY'$XtE j?Y,^ ZJyryYe:ZaGV.j%uRA8szAv,NJsNyLj Ն aa4X[@( PHu =E:JO|JrըCTB?Yз"XT [ `a@F,(J{?.%9vk%Z\/s[Oҗu:J:>nY; 9ᣒ$R7j\=#e_H;N>*_2Ihw#9- 8OGJb9[2E?4QA+@@)k`kQx@8}:?LeMZg\ -U/p ZՅ["(^q]藉[Dz2?!9JK,.LNDbwAYԥ9ڄb/iTr~ќvh*q z_)eGU:$58JYa$ﭯmTG.5-w!惋7;jWR^u%* 3dž⢟ͥ{mJh0|_@s+M5fu _Kr R=Uvrir`FenN)-ai/0@Q5'b]:N#V!x½b:%SVCXDL=d[nL(J#ޝBxEY+cg>MzDsn4[1VW_4KQDp'`.MJ9[6׸??B|UXwTW$ݜi+N׳ٍP:Fz? ,:!y6%Z,v_&B rWEV $7WN1AkNϲ-JSOA3d$stT"(X$B=tbFe|$^V,8UY2<֦*O,qɮiaj䚑jtA褝{qVFz+kWht5Aa4ؓW ,(vKނ{[Wskj5;sHDͬҸڊkZ¿YI"^nCs<\~bq:Ӝw\ 2< T /fn<%G \\^_R'%NQz xY*o 41ҿr)貣c+RVv] %W40wU۸9Y-[#*z7VWSUG, ^r%UŊčNS '9>+3d>(srLjN\Jx|lt/x̽&߰DO-u;z2xe+d+qx~W=Fڹ7P0k_[Ӫ;O޽N4V~ʽд9l5Q4ZZ M )Zx+QoSLbq^®"Uw=踴9$E:$:m Q Nn;jŔnti^ZҖB0ܔvN-/g9KjYc.MV>XGIE4uakI&zMߠjVqeV:CN8E)_Y-T94{ާ=;:24e~ rq{kTۈĈ N\Q$PN*Vn1]n*[VC+p2ؕ^3vFl 'u]Tl݀82˗焫}m[rXrl.(lBDA@b;Sz}U p7J*+A(W-wRh뙆a.sk846va!p3qsưQYadHĜ%e)uN-[W$2FSN>zCȨIjLmgh6 II./O[gqN#"V |*&YG-ߋ/RE-ߋM* l pq>a >]Ĭ F$?%G482~(E^^F!v|ИXެ?){')UY[N9j&u)i7؄6qx3w9%+G#\nT2o]zq~ZP:qI-+UF>|bJ˫;[ȻQDj2r-9w&f*Wp[1\@!9ڭDZuwnd."VI<5OC 4k]ܴZB.xn|):KF<%lY6&t&:9wj24Kb~Rr Ξ0Gghj#Ed^˙+l'RςB0Ms)Rqp ۮ'ohלzb;:QNaQ;ϙ¬T 'eqN)ke'v%QSyx4g_7#&I;lqFAUqj*<7I1~b/ѕ>1u#=CI"T&X'ʠB:" [jyn:Gb@ajqK?-ST໒#2TQX*[['bOh̵(V[ MRN[ 3C(-)XdDh%tŌq`\$k+:hťQ)Ew++M)܁~FqiMa%ɯqZpz)H^gҎYIwV/EZWꈘ*֯[z?aB 6 A{#NJ5tŽ:MfMs*K ΎI`$M-]7ql TRu$U4VbFi_B%^2^ ~D8)ޣ_eؼz#>qKa26p(A. ;(D2u^\KY¬$`j_ p"aq,D;>c0Zև!v<گ }d?!9LRbXZXۈ9tQCY/V?GlOgsL@AcX.ĭraQ BY/ƿxx0 S_>XS)tFYS8!:uKҦ㮚B|A:4 ҵ~yG{u%y}z-Kd,D̝ѷ%xŐNR-lL:!]F%p#q/bQ,͈04O3L4+K3+ SNQJeURPGSVOW:۰XEYA6J^:ʿ#NQ{!ѵ@m1F2'sYY%ȓBGM/s a6Yy,"ˋI. aov^/D)? -tʗS6weɻduhLT8TlH@Du{'G)hJ.JZ&L<\Qڭ%VުqĤ`ѡe1hEgHnPI%sA/EEؓx;:Ha)+!$ذ,T "iZ@*w qT;##E7-a5J+HG~ee"Ҵ\ZB imw{Q&m} CiKTsjnYFU]pLуDMB3#pq)&6!m!Q_y[klG>\%ZB*qQUhJǫTOQ26#S"G &KH!y0aΩŪ뽎Ύ|N+qfBFZM `HsWՊUu)S8pTM%mc,1. nrW;iڇ~L$:w\ŕv +UJ|"Sfgq]=x3ڥiTVg}{VUaq}b笗WU5 x]1:[A¤ .ǔLRPU{w?,0'ZME]\+.^Og2ʶ\y}%_poNءJ~ß7G<|tKx*B22΍saw|W-5Bzb8BzOP0 \?ծӲͣQn)s[…$嫝zZ;;ң{;XL=9?߭[LBYsFsYG:Ru?)W+Woa*5⯗n}Jv~łmTq,0M'TOڕ5Eh,ѓj\r-އ,hd~[Pg$<-h+?gG7yd&"^5aI%map%E9*Mj'PVynq<[ga;[ChfJ\JY'6_ÒO7%fۿ99G{I{}-/{׸m]\mD~t)ܼio^Ýn@4'o*=N4.e'WjVcP( dT$`GyE+Gpܝfۊo.:JMnJ']vIAl= MTZsC<r7ܜM(rwj42Tw+msIJqsxYJ --QrmKU}J\mR\ۿeѱ\b&xӗkk@\QxzQ >|.nGTDd)IUGX&dI9$&61&$ح,_ܭFy{|)֤xRr/x%UvƂy>G -Vt!* XQqi(0_}HKY~KqrRjWKLf|_H|_қb -Bôܗsd nNGN"!S|/q*Vp @KѸjjqO^l#Uҧ &MEr a &+e,kJ^^GF'=UwrT+eI]h#JxrzEŴwJNr\h+1*t^3^i\r[ٝ+rG<4fR=9]n%#d7tq`ieTܱUTOr2ƹbJKD,El,pa`bؤDs{=wq; <UȋNˈiʾ%Q}Nu)-qc*ÀU;OXNzE:ZiDݛ/܅EV$,.DzҊMKklsrU/,K0tTѼGFPG\Xrıքnx *1F_vwDE;8zEuiG/q%ڋd4%_{ &_9XU+sdTbbЯ&9'z;IHeXeh9x-eiEJ L J96w$|ܐ@bLsH9(E_fȑBmB5VݓVFoDssH<4vCKv/Nl^W+p:ӣ ߉{=$Fz{Rؑ|8]ŷT#>cаI}d!Tn 'b5s2|Q@'PRT Nڋ8aeKTXI_NkG4zTRO 7oE +[KQ轙#c0*N-RV{31{~_K.+F(K%ExFvW7_'Ъu).+rK\,fz?g}UE~h,e+Zcº6֋RQ2K3W#7)|z=u*҅(&gnn2I'~k֯Ҥ*kzsUJhNDeCM7SE%ej;.wjX9%&Oj\7UF֒{DLeW%hpd2toU(-Y`]pj1aO($ty[jT^/V]Y+ҊqدRg/Quoik*x/p+UթǺM'"23*"b n 0\,Lk|tz΢;FcG)q~+ie9BLJ%L̻qUI;32v_,z"e)T{+x5wT} SvdZrM){JiJc ^NMsKp{iǟy;XUzXm HR."b=W!#+eĦ9 AFOPw{qyvi$Ÿ;G%)z&$wO|Z."uJO_xzs9]fGgrsè+nrqL $;IB{Ο'Vu,3exñ6z-U5-(ˈcjt-2ӥfZ$4dڴ6 U>%~%Cfz>CJZIc~ciWLN?' *5|H |B6xy??tR^'+= jyyʭ>0J*zIϚ-T/4W挟$Y4=sq^K`4GWftUQ..ckPo=O-W?0m#8!skqiQ#^}%vIdlVVwSבRv,Цh=^<E/&GStHk59|JldMN٢>D3(pypN 7&M;3.)Z,I.LJ1Hew旸B,sرK"b4ժ&JZ(;UočW.4؅dxD+I _q'2I^{:##)JBUx%2!{rtڰ9Co}ƺt>Һ;)JMimXD|N_.K:n\8.y&Oze x~|#ZMz"Fu;pLuy/yӣ oEc5U#ɝnqMzFXqݟw,%EVjױ ԇk4'R}vAnGwԴrXٻwecE؋qg9քj~g&+{Xk`ru_"VU6Ma:ao$k*)>i뾺>;&Fg|Kl8 *X4xq:G ZR ]k.S-|UL[7|c;>MO,ne: ao!B!%Rp_R6z{F .H9;]D-rL(6 S1]HZ^iǸ! ]q֍`~k SH(ew,ZbKahWhx"rX.J§@`yV0^ech B#CF:g7AKVHZb9iiҷq't/ >+o[R6D9(br{d/YDd#iP P4Wgp5;_CE0-qY9V_KW#uBEJދ*zAڋEoE"i*57r@(0QM4ZZ:)&ލ'#1 \K uG5H Xx)#h(VIՃGE,ˋlEZ'l}'|ߓE[F5k_/r2]N.»-$d.E . IEX%fu[7GИDz0m m8&cGZӇq:/V/2KtV.TԞiRi{UYZ_VEJSⵊ8TiE-jugA;{AlEg71 Zj"28U7kg“rXٰ$= :A;rEpEG%F,UGcRUZ ndpt`:J2g@mn4jdiaR2gIً /FVug*]$q3RH|4 &e>!FWR2ofڵңY5'+"xJ!G5nT*CS̨AŌ^%qa]LQeбIJU*rHUrZuEzVe7q8zr*Et$Ta,:4"X>QƼo`Y^,o}) }50}Yhu?z8T% $~n}H +h`-A;hW^͸ )(m[EEQ$= J5Uh&i6:_-CQe; e$z tluMsSϡQӋ|Xkb+7xNI.=.kh~ 2enk3xJoy]?KFnԖm:v_3eGBjj3[I'1lMU٠Z~8lUK ]+q4~0~zU|",+. D]zQ%`lfԖ4zMz~uOg+K]!N-EIТU6UgRX`dJ (J ܓMRX.cGmħ_$n|IFVH4'jQ Yɫpio~J3tw\Wlw(kH[שGs&.rK?&E|iWVw6vd[9ikz=-*.XkMK9eM F-ڜ,חlbAN˺rMGWf{N]}b:B:B;/ĺҔ!8#nqc94iA^ٴEPQL;3'/e6mA%OVW];mJM.^#F^E4Ӌ)y-vw;'.Ꟊ+8c+qgeL $ ?##b.;ez!vl c^Mπz*ͥ'h Z4K kH-A Qlh29J8o73JRv͕ŲT,KRWW8M\dq{iŌ}lQ&!s;S=YwC_V+in^4QJV:I8&m't=(;b5p-@$Eѿ Md/A;/JS}1w_5?"o"!QB.=!4 "KS{^D!G&! a xAc-2N6mw2d߈rsHYvž NSqerG|Zy{)=:c@ 5Xa2'-,ݮ#s,TOļ ʞ 4{Fz6*Zu<_۵隝,FgqpZ648^#\nRA鸂f2Jڝ(Íΐ_7KGQ] _tEEٿQ~'Jz&[WHK*o`ʾWe̴})*7q^ 2;^mɃ>V4[4] #6/.JO܉n/ W<"ɦO*-'aou7}/Mє&wU+ K(X-un>3ʋITL \E"N"Lg$ΒXr#UնXΜ\n@ō(aj[ 46юϲ4MFދ+c%⺫nm5ˀF71C0(9ksq0%spk3'nͿSF\Ju]793ϔV &psrϤjE-7[*.T+p5Q?:aNa7~fP{cQN_ {8*GK MY=֒R|C)<ы*c2Rc$8F \[Z) zw kN8v].ʊS-0P*h\eL߈bt ݋r8ŝяtJhH@]iMriu:aF0n:T1UanKX5crj^& Mܸ+Զ W}jrZRT.}lC_3uܗRORmUj.bZ]+ڕ1pw{mzirMt_W(qeyeRQ^ @ǿuIk?Q-l%*J#R^E'ckS(}d#NGc>Ozx\ ̍ҪعGT^M}Ι%"ч kjv}UtGIAܨك9JT"Jrׂ?_[ Y`j|N+ԟ~N|| 3!]ȝ}Dsu\Ŕ38Ǽ\KmIEo2(= 58:NKpRDFҴs>68ͩ #l DZƾʿ-녊Q'Ɏ9'kemwcaT5gakXu7kpѝ#JYf截tdRb't7BfVK:biƒ]Acp279$i[]IU#UYFyc oVFyN髌>:p2u(I4[ - Zu ,--HP#f+{ ;N5yBP2lR,N fwO+hYTՍ/.~2A\pdjޜ[ڢ1a=9 gj柸[7ٮC9vގV]@3r;gŶi6OY^  &-i=eZ:r+:\Ik-f%bLiЯ[ZHtjW^K_Bcem/N0KFfO Y7t?9=4%- ύY:~!75>1-ų#;sJ[Ŗ Rge- Xs%y~;G(~Er7-'~qіEdqu95@FNOȪo TG\YtvžW+.%NRSWdv%N4}Fsmk -EpL nsyeOq:8t§䕌y0ʆZ{5]*CW=Gwiw7VC®Y. Rec)=zq.+;z4x%"X:!12:53MM2#ԧtG+h!ja9w $[$VI͕%eL[mMz&k Qw8m2Jm׭m*t]-cW թ߉Q ;ܳV/۷3+ĘҟO`B)Mb(mʼnd6&3D`;Sms߆E=&nn|_J+k)x R#9JZٮeŝ~Z RuH]qr~buM'e(.jįU7نD]5;+J2uZ=W$k[%v.y/$sp'c\9| M1eY.m з(nq+ reRw=8oĮE||'5ċ. 6\e] k+Uˎb D?w]ȗj~OȀX,-pp:`WCvθz# ! 6YY JlMeBO6^?;2(, l((*˰ bƲPCa2AUqxӭ;{K5e}7.)*pw:PY5g3xD3MF^/)y{ȘpZU0[Ģ  }taY_ҴJi.eD| xyg'.7 JVjyҋ}bofs7)mcJ|SfK %:17WRnjWC jFx^CM 7G(,Ef=Il}G)9nHjK1;a[Ij:,d'i3]H6HrMx2Ycgee; %bzx/:r9T}#f>ĺ/~r-=&Ӽ*RS%)}hmsVuM& JLrTc`P%6K1ghuȜGJNVk!nnr|JRrTk7iMѢrn*r-,+ 9>[iw1(Iprklq{^d۾~Df=8rݽn]=!A5:s9SiuC[pMb_TjqB4-@[E5c6 `"Ԏ? r.;ZBA^ Ĩlˬr2Q~ELhRfPqA; {xة(٫މѲ-]'KD,_+KBĭ.J̠hظ$BaʲY?5P&<#㚔q$Z9stU,5Г^[En=ug:i-aNx*Y.?[إϬ\BhBSpumzIS,2th\&p tW,z3 7~Cr(0T2o9"gHKBp1>,02Hb a%,6!ckeYWZb,Tض4CPʳ>$M#U"6Dķ+݋)c)qI8g)l9bTmzЌU:z-rḺN48a-;8^[V:vZ$T+Ur/{=*j/EÖUI%8Ų^2.ㄒcx5䬹4FUJ~LTRn;CereKk-IR^y.d4T:F0y/cjRycv&O΄Sʒ|d6|lf؉U+ =3ү'+F |Jմ'`0d&kiSjJq%w%w)hו`޺UeloF*iNI̵SIچ&5֛;N%cN̴eSu4i.vwSF}!K+eYU|BgيKk~DUQnmYeRP\JG2haeSe ՝&mqъ:(߉¢X"Gw /1]3Z~G,dscJ cȴe8RW+Az)|pPڛA[JriTߨIsV8 zxyqe\eoE=Tn^7Hw7=nGetN(YRd$y#S|X+h,KMB~7KR ܟv] E+e{'/)|젗vEmNO?IGBpk_k#([:7tW Usp|luF)nmy:{JVIRFvVujЊM*]y$Q}1qӲnV k7xYUiU:SJVH<4Βރ8Ǫq>0-I-ocT}ErEkvHp^,s/VEQ$ p k01`oE>V+䨵#U.%Q^H}(1!GbgIQD ̖%WCsn hWοM;~/Jx0/?C E3Gg^t|saV"Q,]++A6VSO9xc!^oD-- np]WX+y3 Ql6+A ⯤3S-gS|哏4ΈU)x?{5DŽdu6>~;`?qWV8KC*&bKUW|HRqY 62sBsA@uj/VNYTRl']pN (YcM$Ѫۈ14sQSڹvūZڑi}FCpfi§t9JM[0d+VdY -GG<:.NHE^d$seE[Ԏ#'j{WmHgN\5Ij6$~NobՒ숶ԠnÖ 6ڤݙ{}Ötڕ/ t^oZ؜H(foD2jܖ̲[5m 7hVbkc4*hR}zFPT]-ףƍW*ӽ˸n$N3\WoEB8OiGG޹ S?ySwQ;hr[I|90RNEݹnWѠ,(ևOm(::`@dNØʋ2cVENGIjm7EA2+ȯ }J2N+xY5 )XX}GM`7aqw\Q!Jp.abQwybQR&:Jk M  q$BすEZߚ&ZMڳȩïRgHUte;EϘQZkHMbܭSߚNk+Q]uO2\q,Fx\OXtJeMX:ӆ̝C vv,+TRv_? b4M,xp&=+ă*K*RT,0ub8`Z݋ŵ[I1YU1H:կvcvH枛qT-,>0[ &NJ^NN'R6IEAKj:xRB ֮2Sn8<ɥ5U\|yW.7&n# U։utcgnjЫ-/u8VüE(QThM[Wg |{?eeJJ:$Yug)=/M];HynLzNd&vRPb/iࠕ|2C.Z+~lLz%w?,Ӌ#,iH'n)ӎE4V^RQZOpgr,ļغ`ode\ 8hV>$̮x%[wev/EK/dIS:`c_UUΜ<\B%I)کJ-3׭Xה+$FtGNMM%nսȗB읺ArNOŐiVX{Ct*PuJEo1-o,q*MZ*6VItzNmIY/Xu-qNmcص?NK4%YfĪQ7yiY> մG j "lVd4U$=ɾh8-0#bcE[oP6f! se) . :3Iq 'vlHf_B1}n5 I=ދYUe+UyU ӯV9zeUڭ=duj۶UNׇOGŨjK^1y]*W)md{scjՖgmyhۜW7Q-)szcJ]:Wʿ^"Q~Oŏ^hnPʛղ*4:½98 A7^M,[%ڋ}~5.jjV?_|梓r1"5[_nHUy'8&dViz:7:N P:@Ш!@ QH c$.HAAJ=HYzCHr =j2+S,9kApc͖7:!bU܉8ب]rjП}x(xTBq^|θjuGW|%F\t"f#Jr ܨWmg/ε9xfl Zh2aN" 貸/E6#E7J?F5HV2Mgl'aqg\7aU+,WC%_/y3_|HR8R-J?NOqix6"t$L!$Yۋqkd7">k6&KF[r+)p+>h;^Cj2v0ZzX0Uk3 Fv-Q}M~"uZQI=W1P-Im*E0UiJm8RV1I%r\;.{/YeVFi-N-է*<.’XYZV\:9{=-8~Gā_ *I7~*|^Vr Bۏ5vδNOS:1Qf5^ 9WrÏWbΘzy9+hzCSM=jTͳC0q1ߋYpE(;Ķ|Lm6)dT݇Ih:jڋA.ӡ^HJmވ4^$ѕU~",Ub:]X~1j$i&qr@j;*rćINV:::r \㋪žs*"9qm"4=Y7=6rZI;ghZ.I;n&tF"cRIY%dpK{!>I- t\GH:__9dKPD(RJ+Ey+< tgklEP0BlCBMj9Fu8QIEnݽeA;֗鮩_zE~\ 9[Q+0vdVt*jfK+ތ)3Rth'dSU{2ΝMAqNI=ލt$}Q ,R52\JϭFPvOb2;𰡡)ƓwlaU_}RjT7INmc*2;Yw r*xzԛ[<&D+Sw]0z-UuIz:MYs峉x{B]iig̏ύʌ֜O5g.T40V.Y:`^x'ғ˔j1HskF_IS"W&Eqm9ܭMXqq.8yՎ `' >)ZCZJ,ݼ#*V,av ^gpn~|6EIURVJjי61r`]W%Cq蹮KetmsUE8ITvV^I7uǨgYr%M.,59h1Wt)]wjSky& )B6k{M7wO2$O =+j5^W$M]RT(( s+#(KB'hI#Xz+2vE5h%y+zC񈌉!8IF\]LTWbc[\T;UpR 12^6Sw@f F:V:t~y0@"$1?Į׉a_Zr8iC涯u~2^'1P6B91[ھ "u_F^|Urg"+fvO@Υ$]Trᠻ!Rekŗ,:x^9Y?¿3fx/J?#>+2>?3fo=??z_ȉ fDLo1Y sai.n6`tK~voG%~i-:LU9kjƄa"[imJ]y7)fy $\8Vyůjӥ4Sf-9c'WT2Mn+CEEV\Z8w;ҫFJ(tuZ;QGM HM!,Sp񪛿_| dzw-jΔLS\(p~*b?wHW?cKd~U\՞K| Zy YI>q:?0I_3/^Fj'K"1J?r#J+p0zl;ZU}d`$iԽȏOu 栗'Dhn@;cuzu?[Ԫɮ,\`~ S',MEUSRN.:rT|9).H/_q~j"Is&B~ ڜW"&^dN%Fo_MLj,D8OOC} jGtJFVsI+=E ?Yäck;X27tswK:tT$ lطI~2>'\GKԟJ*k_WN1 usd'K#YMj5bjJ w/UsK5W4uc8n4qR)+'fM-%_hd{hXzkeƮFҕX-%Âͪ*_Gڎ[1,}I~ h7JtsGvp٩;pYa皧 V!63˫XjG06AҚ }zzVS'.2S}7/CZTJjVmkuqW+zO-ev#^1Z6UU;kԔnf:B!W/ppuS~:*yf2=FiS+=dr'5c ]\\-yԩ"TUOf GXfW4,`ȁ:jNd(c*L44B>/RldnO_&T! +~7Xn޳-iȈR W6bMzS~$|F8]iU%XكG[q^?3V?Egc9ߋv?z"$LR~[ ڢ>ci~L}`HF'W1[S2FGH>gXӈTV¶N՟gCd0Z45sH3YI(&k0*rhU!/0Θ"6bփ3\2Hh'l7N\ HTL++1 ,+1_.pNW[zx#ԵYdε! $|:EZ;3 i'j:3l|PNEwjͣM'MOJ^, ^+F~'3md }ecéۑuK#+-qf,۔pRis9?FZ>tVK*948[tIxNTCEfplɴєT%)Yi6#h^-G!iɧn2,L_ܻحNw˨5mx19M!Wb]+v#[Y5T7k[ endstream endobj 389 0 obj <>stream endstream endobj 390 0 obj <>stream Adobed#"/A1/6>8@X@8>DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD/#//DD8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDk"   y!1AQaq"2#3Br4RbCS $%&'()*56789:DEFGHIJTUVWXYZcdefghijstuvwxyz!1AqQ#3Ba"2 $%&'()*456789:CDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ? P33 0@ 3 AD3 C0,Q Pfq 1D`(3pnpLQ3 qF[Ne@c3 @%ì# BcCZ$cXbZQ41V2Y[9H`ff KER_y"q6|99@@ @@ D333C000D3LGŒfK(&b"яJU]' [{]qbn]rジSŞ ^;Kv+u>Z$ ,%t!I]yY<7F5G)f]eXhQ^lkĩxyiu|w%Չ91,1^/+/ Q&#MY+. ƊUC0i;HSR^*keتt2ϒ͔ch)Z42$`=eF1z3P"T#L0$Q 2($P=D4G{i v. d6 * l,BSKB]d9؍uM_دrbv=z|F۫W(+_)y 2'Σw}cs#UlL_x7]⧚NϨ-4P3 0@3QP 33  f ( `!0$@8r#&Q$PS-[pa-@33 8A3,(c=a2X{ư1cZ$ZdHɠ(X f XTa8p$J &(D@b P3@ (X9c@I q%hK Y)XY!aF$#D$k FA(bS+j?Rq>|9@````` f  f b fǸBߩ qc$JtJ{Z'NV|x~X O7['Wo*|ied`f#nUmf\ﻶ!r' X,1鵫H wnCS(g5 @@Q `bf(`` f f`f !( 5X@B0B!Ph8QQ(n((J-Ɗ:6J () `(f(. Q aX=h,ƲI%Tm}1@A@(T 9 " "QP`((@ `((@)`4QcXA$p)5rb13 \[ЃЀ_xW,U|oY\L8>!P3|)Jy>QT?|KLH2d)ʣW.R%me_t:/Hօ5 ߵVϕ˛ Yug99E;Z:J;=^ܣ;+JPY}]V&n6u:c^#[z//XᯜӹhM3&*;hAY+.@xQ% ˛9+eS[z"[ɹ>n-jw˒D [']-3!0(JE"Qh$3P!P$2uL@4ֆ4 TG((Q$Q% ODB:0rл "ZXTt3R<#z>Ӧ-\eH,ŠEؒ7 QR0ޒeQWKsah-21B'Ɩ\HLxzXQPserOv- rԎt:IKMk&VX}L0-3,&kx)v ˅:q>5 0b:9x Z##33F#QǐPȣ͌,P1a83\.\@3qP mp 1qf:q[s1@KŸ\h  f(``X \ A@ F pہ&KqFMg 6 8S\P @3 b pj)D 1lh`$4 @ J 3[[SqF LpbfqQ,Dr(@!C$OR,vfO't zݮ=bcc$W_R䩪rRNjԔHJ Ⱦ冩w}Хun://eVZi f}R|YV;*sP50M݋P(Z dF) F(FMAWT;n402LX]xjK4𲖹a:P)Pe00P+⤡Jmܩ*•5{ vN&B)I=LLqPNww-;Y||ڡtG|$eb6JG^W2:}>\IՕGv\W51D3zWJ˛/s5Բ#S"A>xRyyud 41HmZ˴b39RO$VrHk:7y 1SO/B)Wg3'uʯ7* 5on`&(>f jEXi"0h%'bg+K 7"7'*6eb["TrKј^C/qU2.MF/|Kf334KTϸ{+FKX.*3l:0Q P @0S0,3 Mp  S1PAD  Z3P+@$e(X@))@\5DLQ P P 0@313(J ``(f(@ 0P0 S1Qуhj1r!GN-aoh\yr94)sfƪn[ѩB5lk EkfO){R,Nj0+U~wy'9F1U'Ux*rÕ+=}"$!¤AVS,q\|Sy][@geSN)$Y+RW|姐ą)T!rfA_W6V-,$ԋ)hJ#0VQ!rS3U\\4cH#L4KviƑ2Vxɻ$`HLK,,C޹I!u3п <)C |G@s0xo۫meMwP--أڴh;_yz 6žzrbl஬B9Ul%^rE*ĸV\T\wldhSI٢|ҹRyI,O3sK!G6Clf=^AKT#vQIs0N~#RQf@fbf=uN9!zx<3X̤Mٱ,"6ƤfI*܆ ہİ3 p3. X ]GwWU#;6*xUx. 2ZRݙ'_)JnNM3ܰaKXe c1 P31[ fA`(`cn(X@(+0Q,QA , @fKk;5+ߗNQR7v~| ܖN 3/4bܟh* s4N]Lc(t=oϩXRBi[yjSH5v:g;n+o%Mtq h7~y*J*A')DD"ܝOrI q2hQ[i.1m*k{lɭ~mrY/!xF|'էJQr")BBU pFI*:FdjUnPmƙq+D&,i#mVQ}}`]ߍ%'"\\+ME)Ԧ@4#ĵ̊U#2G I%1z{H$bIb<'Apػb %Oiw"B̴S:OS|LQ"U)fb6̻w^QX,ݺ%%LkK)f\hYf:Rr̩kxc0#<ǹW )|fFf-Ľ[aQX[ Pa)kM^O.Uv`Z辜itCv]-*YEHIM"vxq=T3[:X,f2X 3!q h X4fGa,>`-@c1[ c1Fb133[b aqb HĔ@ cfl4RX(GƅعMؾ=3'd'h^T9[X%4j%I"KG y?!g9ggv ̭JJkRg Ɩ;Nݥϸq8fIޝF©ޒRw|_,&͛L_0NsbJK-eFvv|=cQBqz*l2UnYz˕#OܯJZa< nEv'JP޶rnΧH)FpMaV@zm*ө)gQ,qEJ\u0t'gߨ&NϒFǕc9rq='jO+M;fhӜ)I;Z Mz4˨ aӇ<-{ٚ2ӌn_*U敗^F]ld*ɪka[IF v..YZ<ܥ;YP6͸T꽑_ \2w ^Zhrm6RYd|4^3獪B!12 [nIq|mɻϗM`g-AWl.1V,&Ӣ&1U ܦr͐ϗwL%{5jіHRMZwSY&eWە:kp~ NSgوժf-}QkЃFXxVou+~I-CDՒ9.1 *Vg:ޓnr.X]O-,F"w{hbl78ӍNRj} qݷ7s04'~m˫:1tԝJeWg?@o$q선VAvpqwvrUhۗ$cГ/Ye-bS\JETlsЯ5J)YYjF"RNw@tSJ\+҄\beL+e[.|5QJv|fڞuOϗ}g J|Q1sk$-)vr~ztn)@AD3le<*AǪu ({JعSu։^Z0x-9()*b*zw[<5ԤRw -M>Jq_+| ꎼimAW䲘B^ե|ir+%,m޽a˔Ǔ'@u I.ocbvEn9g1c:Ct ;7,de'Z]͗'8Wn14pӲWK5Ux)R@L̎P_V֍.$u1h_zqV^mGIx b.]? K~$^BLF:>K78)NINYLF MRbFt: 5~LK̹bOOy\.ЋNIf5'Q͓^4̊a*k^*]I_4ѕ{DܤVC+>Q̧-VRIF+;"e*cuiO$p&TcHSio+R}o%eE&+;ilڋf"۱M -/:.IB(S)aa&?!f4OEa# 5fƼ%z2ޒR{UEE7kx0' nz.ԇFrJ۴,t/h]/+&;7R\%Us|j'd~%w-Z97-1KRZԫdb*ieYӪ|ؕ[+:#sFIvWqgWY]B*VtH[bSO J݂*(UDEݙud鎥E$iêYCɡ}.aiEB! R[63afEa$hKXFwFFЖ$qt̎v `X4 X f 0S1Pai  f*A@0A- @֓ݨt5%#>;[ lߛ#N..Rߕ9Jm<1[6\s.;/_1+WZ# I"U'&jJ9BhypX6&%۾)Jaouqfax+w6YƥDRM7m>s\spynj7UХKfގħf悖Å$ғϩeJWn~bXx9)<o=ƽJVY4ʝqO'l57.6NƤ G h|1bbӽFQJQ^v|-ȣWjSM^-;/(WظrQɾh365jɭWիkka7mL LJ^Uq㻷.ٶ/jQIp]ѡ[śV9kPkz odT;N-'X;u0-*>ۢ UY(}rb,y4M쓜8rLҫ6$jWTv|˟1 [&XԥU(>Q\FX<15.\!\3im(*+QkqiJϩ/$0sjc#i#(Mp;2~ +T೻C6/a:%)N.~JMT~-w\J`ڼUJo.F0*'\|YL)I^ρB>N/S8*TS>R58ii gHzt ^Jw}9KM7\+VGmS- 4ђu >*;ײj3:49mY|8n˒[i140w7zG+TJ3<5m68֩j{ܠk1-,1aY^k4hT<nMGGg҃O>MNe1XO.V3=,\fQ[>~KTҶ=$bx3} &VW/[&{>ƣE]&Y[EC,U)y+ F4"d:vo6ci&w~ =i//DuW/.f~ҥAI-)LY>>IpH}[xc]DZ 4)JSj7)FN4%\L!A4{/ -i3&^mv˵0N7\e-u)x5fה!R::pD%s77,wnMrSL5#'}׭WA]<כ1m-%R4F.Kr .^sB;6a}L'&| |Uh+ʤT(-8ioN[kٸ.n5%h4ԣ4e\Z rqJInFѽ~[_ȋv,2nNhoMڳk')m/,Zxz*Q)q4Uc-!MC-F֚[`flv KNjgV4+I|nu 1sQ; #2TXxF9M/p6f'xQ~ccfR-R7>yP5jrv _ Qs}oUcmdڄR+M٤!vVWjctNKЊQ$d|SKfqWAIdC:k WbR\TVWa Zwwl-,Rݖo$cLI踒nxNTٶq&Ĺ,zIu\mWvm2>KY"uPݛ|iLA." R `%tQL 1mdva< 6H̍d%i1b̍s[K|ȝjG~I)z [T 5wG8f&Xp -a#bn6%bh32;c1,7nf \r6 _tZk5ج,-=ZgM.$h`V\`g* r1rwlLuI%umK=h/XK =)xiݮ286wVIVVO•| TNȣ9>mUq6q'+&feh\fܳE̹_bU9JR*Iڮ`5Eiz[--#V3{ТvMQթz;wMў"۸CZu:9qgn(lќ[ɮ[YVf&'ozi'lݘv"g 8K+t&MFKl`I/~D[Vѫ KJ\y Jpoa`HrRyelyƢNpTsz\D IڵE6)MuŘQ]ל'V);>Vlf ^̨ҩ;6I^J S~sPS<޷e-lhiʞRM\^g1n%-nrCլsX%NMo_9vF5cT؍mm>giZVWbNS#{B5W\~$j |v~"QF"]Rӕ4*Hm MW]U SWeǹ=ft[WiBoN 8U9ʦydI%KbhT+9gi+[c]LC2*0Q8. -MÍ|[|{ 5WWy0[N,*2Xݣ #J*kIMYno(QK_5{6xƫ^CvK pמI/qឦ:B1pNe~<.2ky<k,mѧNVWz_)Y$W}dFH6YAS߳QR+k%(QTwB/K=(1IkdR,=D8)']>xzt8~2hUĿdJrˑc +b_ ;ڲJ\VWkttӜoRKuXfh/85*s|D_TxhPJ0J+Z+p4Vo9};XpSNPXA+٫}8O?UXn@[ϖΣ9]vXϠmHzQ%5DN_l|?&>˧-$haܮ,ߘ5ʆ?fB.I_S?RRn|eaCnFT4޶ o<:{-9/ʧA֗Nn{^7M-,֝\|Hפo=lrRnInNwjb%vzs~ 2OT Mz~=ק:ߊO5gn "JscPmJ<]ZJ V}E)%[|~͒CI ھ_0T)^Q}ySRTӉOF>Q GIbdm.;<iAJI&|yRTf c 8Rua5Lܮdaӄ]gc^&R] I1JPW\S+Ռn6hࡇLۿsVyqQg;R}=IS&E|GL=782k^f* J̫MBNólcdojXxL=WV1QnזŕZҋ2I,"q5:U9]jUIm ղ2[K^Kt})../9_.JXOJ]G&%yFkCSfb)KUVȅQfѮún: c M+M|d"KIҗƆh6>Y%*pBoRЛ#RR_# 59:S[MvR-U?5 jf݋xyJ݌ДuFj@&fewU >ITZ'tR:Q%ISy+0َW&W̅1wS%ḢLŴj/TfR]8GcE:ה̭MًRz6 RVr ",n:(K^䱘ژ9IÂp|~өMvO(fmqƱX@¦1 a8P P3XP3Ah@A F!>Xh `X f5-bK k F `LA 邑ÇX,kj6\I,%mH.1C8ar鍬 ?~ڿx?=CĿs;W97r/Glʮ"8N,*”BAQ5 -8Y`J7|#FDWQt 7i01Y!%"IdQ&IqlMhsvKC1"&c-1f hBFaf22qӈJ6v3 ԕMx k+YwIS!' \T`aV-HȎK@A=ս5Nq\(u -z42+[k1℧Z1Y'Q5E46~q-[W QvըZlDuTPT^7P+qˍČKJBGP4j+OT8CBY ~iUXɭCpzynݖ]#'t ߉Ei> =^ss^RFM 4"|aVPV\B3q\UMiܲBFM>PWQݚUYD^Rqz w55qSY&/)NWI<+ R? Xl/uZ.gUI++0Shh';FI IgC=8R@7(mv}HLNօX\F<'i6 t8y+8_.aPɲEs߸$ŮoEh5zu)[Rܕ%K.\50qWϓO1%ZѵlCӉ,'+m͘TOOpe~a=%5deFrVvi[Zj=% %;*iK5vg+R9`h4k(Xi”+f-+e5Ƥ8Yywdf6[>Pm96vl[zqR굵^uUвrUvMZIF6Y.f o,$x7%0=ֵ9ڑWNIr,ԡ5B0w~5\^A3(Fm}NRw k-qWLX:曋[N^CV>3nkZ[?P{!%{Z),MenّV2U]xN^PS{ zlR^AVb=Kr|՟H#BKjj5|˴V]S- MJ*6M-ڴFr?%p=QSr{UOdUnq0BmEd GeyZy>('vӓ1c ka"E]E`*.J뚶˴=OuI/ wUnrUߍ'~ImN۰d,JMacENiǾL,Uߖ՟L =+ߎ! <5]-䞝[n9'yqBa&9YIWVӑ(tiJQJh]U& MӴ`7XC4dKrfV'kM5{cPUz=%5%F Ϣ]7}|dvυg]ۭG)ܟj nW}>GH\ʕ8SHY=4xWxDxY<3k eƇƽXi&Yt551ͪvkIPG"gHkmZeQ>+~*aokD#56gTش qdV49%{:ycOIys5DŽY&hd-X|WA6R񢟙P{%s[9y`'X`S:an閫a$_ǟ89wGJ󡯇_%,$j+Fj㗤Nu6}JzڳI'03:4'F7#wdǓʽeá|z1z2^3"âdXt/ 6 <ɺ:#1\AͽlQ'D~x?lݖ좔Vq:Ɩ̧RV_XpQQs6j픝/?&еJ݁q]GXk(Ռf,pQeS)`Ho ub4F: ;CjCe/ʭEOyR15Tntxn:8w1NsMeR/H MsK WIfe DMJ5kꊺ\;l_ZY 9ygW6 #Aa aP!@ QDAD3f4`bİ4r3al"!!lS  f%a0,+F2H{ Dl(p)a޶>Q^ҫ*Uh1BZķ*(m<|%9ƲtsԶJT.cku%˚Xb4[&'UtQ([|8Kꂪv݇+NM-@1iɩG4`z۳!nϣ*ׂ J2M-Fwz[mm,/;{EHSv Gwyffz-$$*Q~OQ^QIBi˴O39[+,^Ϟ9V8FM^G ٴ [rٲ3_N%Of3H,ARMveoػ=9. ~U)Y8:ن^O5Yw3UaʐyB9'+nf*zT6,xfr%_S[= U+s5Tx/(}Oj+ʊևyXWe).kxνdOeba{|؊i59fX|Fo}:׎o~FhS8޽#q*F<,CkUx &j't5ClJY[as`֌1oa[FڴCe;^ژM1cgdkJ wtq9}n 욘9$ ,%FR wRO#[S*KA-sfXm%m.Eg5ژ\ ͅpwʷtvNhߺk;N]fǴmU%*5e8<)k$a!]&2'Tk%֍mL v/5X%1QwޜmR( kĥ;ߐDž˓3T"28x#{s5"qG'fD $I߰H;#2%$I6+i5fD՗xXM5 ,l"YؙA] |#1iˣo+w%ݳ`ta6rMXv`:c3Y!RTf+w3SY'Q[Qkuwt(Mr|PP}%qwDAM32 ]RNF*qjhEERW\1T!˼MSmNhԏDԌj)g$Lȏtt ։11et7%֓#5ͭnBlW뾼 l}_yDg{&517B Qg ]> Ck qr)S]WFMnW|a7M *Rғu)jڿXUV RgX3I&UBݷKxn5#W*Xٮ^D=m +Pɶ$oT޶\Aڮg?߬rڵ;3Uk!ժQI,Cڴت=Cښ{q{ښ-x)fmmēI2hIA~ѵI=`6Qb(J[ҧ൧eUҲ5έG=XBd*^^x9erk)`]l8`KThm8ٍasKwU[+1eeG(;3lUSMӌլ~V8Llsw5OU{&v%XG.W+I,̭!ʴj;yP*Rڣ>8Q;X52zu{_Vi [BO?Z3jPP޼Zˊd ϯΚx/2ZQ&>cPUUإY '0ťMx_[p4pOV\wDExe̜ mRXGJ1u'lq.<<5_* 4řΝ:fN/YtG)HіK8jeLE ӷaqfLdq`{Tp]Lcf6Xz9AR)qxu:A:^+hi[l}v#x| MyE''))&6 ziWig ߋR#iuspXݒ5R엯RjGISxEoYf|&ڛgO`X׃-.o[E)5 f~eO-l56Ph+b9^ǵid*XqwdlN[Zt4aEu1=#8ZPm-reͫw/N헫`WM\21ܟZ݈ܭ~7 ur{axXSsWz J5J, 堽 Y-yLS001@@3 f(\@3@08@1C1 .)CP E.a(( ``5K "Hi|+˜=<W1zxEYᣉbKr̞qz;Z*1rza5B+.19,chIBVqkJ/c>&8HZkmER]Cj;2z+fRTlN-xh Zka*Uލ6I\1m/2-JN%/{zX;eW9_m)\ĿMUIbU  ]ISIժ)->¾73uUvVroab!.~sR]ZkקOu󍧰}%"VjQo 6~)'n*!tk LZx-ڵI};Saʮ뾆-Q {<¦ I)yl2JV:I;W隆:[.BJ8 f_*BJ%lD<c5 tf5e1$?%qPu-BʞM#+qYikzȕ,[~<0)2<)$6K '(HuiT׹7F,L"<&ّts{zoHUx<vTX5J{sQv/1TPi҄s@#Y[۲!].)F\DUqt%&]CeR=y]&QaE;$jhi5B"Sޓ/L`%6%J eJzQٍJftjkPҺR()$MV]cUfmU'v#XkI<ՍlQf[ XZ75%$ 1Jowqc/SJ.&z8K~v]ƯLjQqW ~pj )]TLZw~b%^,Ӓm+ٻhb`/+7mvAQ2[/%Pdz~ɽ+=g>{S k˲m#Bqyu3F;g/PQژrsO9ټj^X;djXCb" 5{f˨ vXWa :Qvu X *K3 \ZHKYbp'pu02_NS);Y8?x| v6vij*T gPqiU^OƊ[3CiR_i~?N\53w.&-CI)N.fuLL_ލpqR|df%?pԦn[xDW}[xJ;S;3RI|r0ov݁ukM6 wDq&Y5f+$q3!$L(ٙ-C2]4#FcT hۙIFJ\DQwcDnnqNwYcnj_w638amU_r(vbHh.&qwWQvޟnN2A9j~62JSw]9VRAvKUT2}v*uW^㢿cDRW2,jV2-2t߅*%x~`t_lRiI)vQGꙷiӷ]gV%mZn4g9.mZ,T%w<W-2|)9=8DLjdS(Br]dAf=tx>زoa-J0n!Z|Vc#mƝ(e*Zd/p)]>:IaZ"ednZ9atȧHӞQA:LDty29S0ѫ\M}:J-uZ4S?&`՚=-'$#&PKnb«zJN3YS[I#<=wqO;Y-4Qswm΋tw +Mx/b0jyy6=s^k;>,@G vTxf' ,CD2IIE]9ͫwNe ;^Xv ZV W Pf󹻋7prdԥh)]LK3S?@0Qbf(bf% PKۃ@ r931qzc# %@3Q p`!F9a1pг:٣BnM4ao Y:GeCh;8HΗԵ?~OY)Kٔ+לⴳϐ:=^VbiM^V#xI--/X河o,R6 $sz,&`5d 5kt2a;la,v^Vv5K[f*1(Ż- 'yF[;>c*f_vUTBOzF76?)*u|W=$DϪPJ-x~ԶH40ySؑck/ڶeOm[~MLv!|'#5i{Crq4켦z2WV2Ή1#)_s+s^5[j5^K^%?EnJp"g[W, ~ViU/!\g9=f2}$_T/*ۃ;raR)+<&i{]c|&YoVVniA{roEO#$t׈fBwSnb'}+m*PPN .2 kM KibVa985v'/uPiZ8 I>5L2T'G8QE< v JOzF+6=iFox^ysǵ#[wSХًMO}&0E,D-!js6*lJJҎ]cck(4sz+ Ovw)M-^[La+.MB7C oWŖT pݖ=&#^\Fͯ%Am-taUfaܭ!b ЄϨ9]Ŭ^܌Kg4z9K;?!&*>q,+eumD)]H} vv\ŠgiʕdsaQt~Dfau뾫`"4u,d:)VUЖTWfԊPgasc2 \_y O e׫w 5ھQ%q1#OrZ 6f׀C?! Պw2W޼jb-'HrI#Fq<mz%krٚ^n1a'IBRImNTkiIf5mLvpb8ٍ߰LR[W|fkjc6͚ɭ> thj-׫ mEʜhY2ogPyʄ߃V/Uk^СQvjWƋ.Jw Z6̂W܋Q4I D)F,ZJ=(}jAӆI#Tב}CeE~ƙqcL+OfaJ$h5nT+OIkڟe[!9>fіW l{&ԯj%sGkң+JU(;4u[v3T=Jn PQIݲ\.\9A^:>F8u]NE<5:T6z ᾫ(&4XmG '֪Զ I';Khdӷ͇N3װxL1^RwOm f"dPLS^TuC% Aڳmq.WKn[3߀פUU/YvéGΜKƕY&.4_:J\Ӧ2 ȥFOVFqLv)mL|i-՛ E\bSޛ\Nc.[}#*ޓ+ [ce=ūS>RYvFd+$6tY,5Z&XF*CkUd\eP7[v ߧ/ʈ+l6"^sVZM4MmIV6nXޗRc' L-o@ 3Q pc%ĸ\,[q.b. 3\.%@\. \QFPA Lr-PjCf8Qa+1bC1 侩ti?d'[9&5q؛%ų&1VEC$ .V?L3.WGBhG~D; $֛Ҷ}vܩN YZoAc=̇A]62(I0TV/uěo;)o BY31c,F[X,j홂wv,gce Ŕ-c2YIY ՈŶ"@+ ꖎ]+1-q\ɷF55,֮ ep'-ħRVdt8v dM;]5#🕕$ְܻ5rv6HUi䛱MtjYVҬ[Zxσ, 5/"^Ksm3痬wJY v\#mesw6F<&[s M.X[z)<;D6 y"b-As7[i[V? ߋ#q8nG695i+ Ӿnoa>]?j,>Zߒ5`T߾;3:u=݋3rʩOFYNыnʣYߤY'lg.CN3mBDe Αk|Kc8%8Wk(bjomקgNIEۭZM<Luy)#NM<ަ )J)WF|veđmj;i(Zt*zwY}Ym|nڡڋOV[qyipa*/Y.L!*Pn|fyDꆪ|(VFJSO^LmZ/Gꎢ|H0^Uv4 -5'4_T4^DEOiSsGidҲ7=@mMB +;gO?ۺpOLĭփwnՠnQ/ ai#Ii8nˊ~_s~Vĥ vۅj ^o)?rOMzzLboqY:TjZZܝz' )>,$|4͸Hϩ1&*o5pt;It$ZRt7g7oD>7~_wVGn S*Z.'662[FPq}P!$4ZC%K5no4IWdW^PݴoeAҤmLDi)ofPUK%][Ku%<5KJ6wIdjj,>֭ZvvӐ6թZn-G. >7wzۋ]ƞ!${^w<9b֝F9E%A* #eqijn1waim58N2({ 亁:vҷD松B9b֕ ֚j KvrqDi grjqW,rYec7ū2xrJO p^oͮ+R; KpXflt00mЍ_PefۍX۴uM^#V5c䘶ӍӀ]Wm;=x|.YzʵNVmgCk*-JyZhNNc#tn^JWx|}yNMz9hER|}0,iW)ӓsm׋QZYfM9L%BN,U5 FNsPkD3gY;(|R$ݪ};Ebm8ի #Qߑn&3&G<[RVzFgƤđbdqR"-J ,*h[{ ԥvXKNmV#B|\_Z]2dߟopRhѵVli>(ʎ.t]i'/FJ1[vH7&jriUrV.Fq0DUdUk5lU3^fhe [ڋmB̈4)j-g"cEy}OccV&ҭOvo%kko=(kz-ٵg5 9g]hу-ghZ?,U}>M2 Cn2R\ i7 Y>{p0lZ˖l\3r%|ޢ R7eRK3StN: IU$Reil7~Ϝ6ԩG H:O[ 7nIYiʛJ]&"}Yyj#1ȮMcz4OV6ubBȝQdE%9,Y"9/ AhF#1j,%hW Z m8ݡkIIf6&a%pMf%fVحBjW Ě5^3J3ݢUⱰY19QZ݄Yf )nwA>tBT^$oaW$fD$fcdnuM{5hov%@ J6`:kN2+]1o%Ѵ㙙ku*WQ%B%+!]ؚ 4% %7|zo b|'Vjwj.1h씸,$ Mp,e:2ȎZY r9o[PE^b91{!b1FVmiIf,MzYܕ8InDׂfְoZp1v#i˨*YZ8\CeSE$I›ѴMxNĸYnՇTsDҝ8W\c/&U*rmic)Ͻ. OiIbԙ$]7#Pi;I$[@5 j r'|֙ԜU+ՂO[sG,kYRurouRݍMi)>#&!IjM7)oCw^k,Lz5G,eUY 9ne|LV96{$xwRie%IXֹY<}LmrlGMnZMClFWr^_ȧR|Hkl˥-m09k%h۬-nVQ^B D/vin}?4Ҹ &54d'W]U9.!vW#ߩTa+PU\m.N.3TԶOH %-8!׭}nV20TԵ*ljҞ]k󵖝fjU\Dη_Q8ݦ`kF*}j9]q`0`p~Ap#,;vscߟfQj͸aEݧn]ݕ_-zbJ{mJZ ji2k5;;"ŷ+;/lWJg()wX^. d/-&[MyM;2gacis%śtzx,,5éIyj{kJ!VݨzKrebiR]6+ :#vjYk qTbKrz;@C#0!EQl[v=Pdcv0$fF(:m<:!f=֗1Ļg-Gb,UK? 疦),*03vҕ'gv~>u{bҡQ\`,> %{+4م[2ނ `:z0zvˍs[CaNRVvyfC{u2*rDOZ*G̙SW (p}ygIpR[љ ҒqrY27|1Uy7UXªk@ƍ:3Pfլt!h`jO.l16e496M*Vјtaљhp `3Ѓhh %l Xf ! f()1LrnaKp#Lu'\rdc$L[BKp . frURH.I|V^hO&/Arsϐ'㜤4{;l\R աʃa^s P]l\.[Ai|ToY.CC6K=&). 1jӌӿ<pĥoZRkϵy9S˷oFORIpNӃ*ƪHh*!f)bG7Ȏo&TfiLV!mDVo!IpQq!%oqg( ZptIb5)koPWkZBj+ȏ Db{נUcNĬ`$/ >A^Fa9.L}Xnnrd~(J`$.eac+4."3(Wn!Z#qނ]cF\KvwjPgziZKq͏HW9˴Zd/IKw∗~cZ*jX+ϹE^K6Z 7%īMkFiFOm4Y7ujP miYbirKE{x=fIX)t]JතU-GQũ5ɇVB% 7 K4 1m[vfRdBmiƭW^+GDjkPcWi4v'8hdW ^nAOI A^HfC%kC[w}2@KBS^<(IfUVk%W]b[A5.І36.Oq[ԇإo)t4טG. 򝺅G ![݊ Ytb^٬^ Qebf6s&'6+]dSVlZ`cIJqɒMd%53 RH/ J0IkY\H+HIf+  Oحx(̎Ҽ%e%Kj?P푥vZwh&JO-.l%7yS]ƹ)$2m3qˬMJJO>PNZrJVCJ\ʽ5I&]ciUy656-ETo-oڐZN[_b^㌫בvSâG慤S *k6[[}ն7@ڒjFtS+~ V=b) ^Sj NtSW4(mȪRo\RM/YkㅨBsN]-/]^%I+)6&:i&ڸZO/h_$tպFp%f %d&C'uIv׫TQqKP*U$;&3MXx2*9v~kG0)Mfm[b}CFЃRzFS]m[ћBO${՟&5o(*Y> ڕSޱcS $?(T ٣'e%QJ*;& K@L5 {{DɨnBI%C5aԳjr݃.%g^kjY≂؇a(͟t~K4xv-bMu/7X|Ti\wK]+Oo9OB1} qSZRߝYjOSV2\ |^S~"6;3·k.$oQwwޱ% 𑧋Di \_i%UࡗM2*0\PlҥP-5)qv?p)9 P(OMSecs܃zfPCS'.VV8>c{@Lю$i +upk/ Q|oרWl;k TohV~T6-;;#eI8Kv6F#TI]f|5./$kkIV-F B>|.I^ 5:*h,vuCI^Yr. xOHgHEQZLZɭq.|jFނ[Ӑ`db)R1:4c(M$2K;up~S"q Cz΄Yqj1d>؅jtc#>)/  B]`ׅ'$$=tuDuz2XDC[d@;;bR^qb}l ۨ;͏o$ů4` x}h8%~(OԎ+cB]BӦM򹚌)ՕC*;KC-;K/%03ּ.JkC%w5i5SQٳ1WΆ5mU9;_y}6QA2SޣW矔#WiGzT} h VDZ>JIּIx(F1ѪA*ZMo @vFmTݮ? V3#Xtf6baو 1C!7u0v T#J/,zϝ]"Զo8ьU3ŤmSُҲ,s_6X܎,s[ڍuK<<%ܮI=&"m ; > cv^' $ᕚɵ_h=wvy_Po UӓQE*/AlΒqqv"Mʔ7nZl'=9Lׂ Pnch(i c0X/hI- KS\Hkxi~h#]7idlFYRD>HT_q]JT XeFf,^@6O`m6s16s1\P f(p3 q.f  `C0P3XP3` !4S1.:cqna:4T= 6s1\KIPG.#k>QcN%zcQ(_6Nel1V¬%Gz,vcɾlשfҚeFdn tN+VnPc6+se-SڶEeFpjڛLM!Rry*ZV\L5eXYf[%"IXaa$ׄ'!fT`MA3|gKIڕG3 GbUϷuc~]A/ G ~9rZ釗[B`XCBGx˸ )kW.n-1"Qˑ-[:"VnZŒcɪSA^Kq>#q-htڌ_0M.!Zï5;=;2jh^ ԓfUn۰uX%OTK⛦3Z'ȀՕGzK1(22*ZZd:hAmgzJN$3 9=.f( (۬JrK$S뉂v'+^X%9q + 55JSmJRѷ⭫7duE&#Rkd)n)Brm*Iyj7 O~ivfmi6+U$ 1][:`%»OL&{Q W-9v2J:WhM~ ;F].x+ػAR](O wM{j*6\bҟ MD8x5Q;*Z7 6_i.9(v|<]^OǽPR?ajTazIOYAV[vգ/ /t-C~9=l$|.[Vj;VpGw O' d&Z⣻f^B:7Y@hpR[BwʚowX6:vWWY-ujqDUi~M; kƤc\ѦF#yHL` x0^Z­\RFM R=ջCzg{Txn4ZѕMpBNtxDP^PuJQ4lJ1hI5/!7s R=bUGo^ޥԘmQb`ܢ3*Q>+7ZE+67Hz]c*G%¯ IF_iRvj1J\2DǸf)x~CDQȞn%zi&K}`{dpnUJ ~ _O)in'*81)AJO #4]CvvC]I_1oXjP\MmhkEv vKS(CH.*N9S0 EzxW,[aeWi\ h캭_u%vDe˹ecFO !Ѡ{*87Lt^&]I yH`R*^`35YU~F9%:t!(2u7]7pN))eƸcܖ&Z Y'1YT8]$Dk)wYzEϋV˗ iE.YQᚕH1^KqQi *y55fb|S]BRʌ=JzNfKA^s!o}۬Ft)JT'}7 Α|~sV4K{x|Npw PYz+BӃ&J!p9E;zkh̕Ox^]Ccdn5.cTnOd=&(;j.i@f&hIW. 8I]dGVhLLA]O _iKDOIRjAdOf̺Iw.^u[ڳ9GB=71N7dSEyct8F받VRn-eZ?r#vEh. h[Ӂa;JSBCenػCp3#\&r}t|*u bQԌ:5mV~*{i׆4@eS⤡>izu/MVd2pcpeihe4{D}}=KN7~Lv3%i3oĻv8+Mr55K9,o;pe %cPX5`G I-I &d 4!$ǁ($S jqy,j4'V2o%*xO>G')dnX&|gce.&YUwlCq;rS]ǫZu4,q0yrzTPkM AVBf'gʖjI]2Lӕ^y2ޤq ڐx2^bʋ^GJўkn-%;R*U#U7GDa$"lvʫ%ڂ.Z`1,fg.s1nb.%Ĺq.%\.6\uncq.f9mC1B jcEppۊ81 cETM۳6O>' 9nžI*8J+k`qH/Y٘d6%oT]X Bu%`ّۅ1h5WXN 20mžD2[Էxq%9̍,1LF NĨfD@KIMI\fhRiq+TVz2S\D4 j+_c+~CHIDMNskUM am3*HW:mKN ݖ! y*1rY$ta6@⮯7nII[ˇtO8 7b}#Ѥ>TsgT1kV(.9\faR12f*E={kԡu/жƬob$XDnyIjj,#f˚[>KӸK6U/.VZ!̡*MK$Y<ȴcwݵOQ`;,`fD*W0ZNE4x_hͭn, JEg1ͼw @NR_tG9Xi6v8/q3_\<^tV2bi!6K3TRʕâެ':!oYh,ƴxYxf,|#]YA,Xi,tH-e,U:]i'%lA#eOFv˸ZQW̥V+pz2~ 14} _ N+%w#DjpDɲ1hW1NVQVT̫)9h-+>~n[Vo0I3TqUMlFݳ%Eru= {l<'~#0iSo(=XV3T+pu%Q,?Y%YTLwI[5KmFulA8Sk7rVo6XˉiO&ڷꌥSL{.uzկ75;p\B{:9m 53:p ur}C#x0kM7FS㽉Im(;t\LDEo⩊v"Zj%"'ǍV# 8 {U\m (ޥ"kaC)x9x;&z[}zN[ܣoi^z㤙O#acJb n;:(S\jRMoqia*NߗY#]*w%ƫ͓rNgVW Cv]A([K.IpVH: *#KBpeAь#W;ѥ%S5JI{epqӵ3}w nMr%N!f5=4p yN&ޢat}ҽ'Я ͛| )^ J2mҕ\;nA3Ď*D#NݒUΟxv O)v['Mo{U1q]SK7O#ɕ )vv+We 'd`7q f13!3$(Q1Q|I H8H3 @yu$35t֝6#R./9-عcAqsUV~A# >fN# :=9S9@S1I)VfFfK*e. sFR5p;QgaC.F DZ3qX暾F}9 +:NFU㣉\ȴlF $}UX=WxᏀ03b #AD3``! QZ]5,b1B\.f(3qn0[\eFŸۀ3ϱzR3pۋs1ns1nc.)VrKjx]|N{G>v^i ;k)`)js9GO6e|4'-VNiܝa"v_yXsi%N!JKeaguf~1 ц Ȏ EZ*d=FOWbpS[,풏>}=% ]?O ;V0M% Dp*$ճ\˸Jse3fUxAzydTŰȾ#`,PF+Ѝh8=`GYc0īn$ھoSxUR \csTf`%|Kxj1mqTa6fx >َ7%LZU87ֈ/$hkk)EK7{=Zc(Ui'nG]^E4sjPi9OX7:[4ԌuHQ#FntOu$EvrUkKQԗ2m8XOV[S-ʂ"nȕRakUlBy GP ] C#Ďtv 7QZwa5G$Ђ7"Ef"4N[ޅ(,q*IT$IMҒԉĖѢ'NM+_؈ŷ"I5J=WNrڂ 9\#).tr1Q+CLFe3]f7E8> ɪK1jc#6+G!$s.91$5dKJt KԅI$c7AtBY_ *kuٗ#BRѧ)S IxKf5e,.bK tOOx w59a:4S软B;. NntlxIߘƔ,4ʼ7v &̓_EmSqZ|hϞϔS}IH}#^sՙVQ3|:gʕ'_"hBT8q,|ӰXfPx~ sBJ蚕ayLve#65_,;KGf036%CN&kf;%_[)QW)FFkɪQq+J{CPS][B||D Uqc.^Ah<HXl]Vwntu'KD5kƞ\DوR䄍7Sv;*8Zm+9+۱>OjRz"G5ԋ%XO2m琉rZ*1q:5xx꛼L%&Zm snl b) `Q`"Պ'1@THDJf GQ)dͯϔ\]R,N8%%))[AbZ%AّV  f]兒qkVN-a1rN(ۀBxYrhc!Y!\i]yLeatL"Sud\@VN^ k4S>T 61s"L\݆'R4v+%UK2)Uo@[-JdVjdT'U%,tS mQ{S` Ś1UKT$.A!v3+4F>:iRͪ-['%~ i,Bv~NQr2foN+uxVZ5{[QQc\7|l#C0D-űHߴzNZӤܥUi-9Qu\nyN KEΦv#nsc#c֖-QPQ1j+#ԗJ5du3yF;O#1)8.Bn#2& WlsE)/d-n,2]^r2w i.\||#1GZc̉S%Y&kMqlGX+LHwaFi:.3pMK,=9'3z4AJQLdD8VMY(zEݒ32:k[^"jsj#h%?tKh3ڽYu=7>"bݦ4|g,x|-N->Ҳ]ŷmѴsMniDK~ /. btS2xIrH7yB10NGiGy ,6w%ɰLQ')VKA, jws3291MYzɩ)mJ:5U $>u|`M1Sn3~.Ԓv)a6e\s 伥'DK͕W;+M +0LL4 73YF-,;wɮJbF&-rKRQܓubXy,cRi&bw~q} ŧ*XXFJ<[+<:fff`ffORR'f6:: f2cڃ `>9)%!] %o4f1 TTjҍefcpjAN6yee-4^ q*X W  1L)aet ̖0aumZ3SU՟- u>"9'٣6E)_ XߏNhDF7$CR[9f<3Q(K.f( s1nXf8[>_(S1B)XpcBì al:cıK aX,f% `ExKKNw4!P)+B=}f44ɨMA9D DIF*NK1n}:QؓnWW{[L;d 3fp(!LT)+TǾy2P\ L\!}eLNmߴ׾hTIaVuۻ+oJCE1ҭ}xS,F4h4 q<(HSEѼZ&TW#B8$~B)F 2vI(pv3v>7hJ{yek4QI!""&tx"X[؎qFd29Ϫ8u\"trJo%`#y-ڬW$Tb$\ڕk|`*]e &5jùdPWOu;vj]J+5~64X .VdmZf&Pefb{p|6uMFj_;>пY[ђQx ҔMJvocZv49ݳUկ 64jJ6̭^we܏iVJlbոQB8XlM'qԉ=7$ F|SmI6ڕMsDu*$GsS+(+ =ǨV)6f: 0͡5JV-{KY##=("MԆʢY# l֮ðR}ORJ){L6K[ڼ)Eubu76l^!w]f"Ɏ=ha1oG塀jRo!c [SaE%I4uz,=#/=`Xf-8ԶBt{2:7WPj 4J  KTJIUHl1i5WeB'A{ɥrna^NvSRc)tklQ3l) xwL ,/,ݭQ3wЧ iҾ.&/)#&])ѕv}Dj+uI&iRD*LY Q$hkY;.Ѭ_ue>.l?E =f6 N0gN:H1iNo+'nd`maFE^O.#:qRҵ3c1-0U)ͷ'ŔZM=LbYG̖yR=dٹW_cǿ԰Qx\eǻtO'c"烩F*T,^WZ .%᥺a!.}Xhf833?K)@A BV4 3@0, Zӱ (D(f-`)D3,AaR X mFX \Tݳ66Ɂ8O*2eM,hR/vK6,RO(,2jCQҿ[%QoWS z,1(˱LL),̪?p+:Anҥ\[Lth6mW0ÓƀhѡːÖ#G.C )uv!cAƕ8`̞4 i)f$~BRӡ, 1y_o7#Ff+iN,h gOQϒ͙Gf>M+cg--`\kj^\3^5E;˔'LK~*\'gJ5vu#ߑ3ɗȎRCՌ F#3 k3h:ҿWݶfNRS[і̹Ge@Iδ"߱%}Y>#;u8˨7R\[h+P$Z2,U'^m /IF.\YRPԫwgn"xi^@&ZSo'Sz2$imYq$$Ƃ(~X2rz%!oӔ޲mNhϡ|ռ7MY Z594Vy H7d;AwٙLKd3#) od*V,=r#6.n"ͱD"hĒ1(q۫*i0 Kn阖űwMbʢ'3ޑBYrlk|@@wnp-a.3{ m;SB1cM2XѶcy>e5Q2ڦY,0ȫOZ&*؏}ሆ[ Tc{+:ҭ?ߩpW6b3-rbIdMn6PVViNQm t$p*J<V/%&g9t~~s/ L;  A dcD[.J۝)JFsKF*m;^K-X3 KVʔ-rX5,E>82-ZedbZ2f>Xf. }XHIMsXU4% h\|"7&S|˹szɶ60 ,dxz] 8ǒI"se7,M7Cfvq;..[r}W˻"*Q%\ѝbVϭ]ޓPxZ0U8,-y(fffff b f `` XRAnfF[F-Pc\(ff`a b Df&' G^.XQG*?`DiRqz4rJ6[ t-aL͝飺d.; xԪ:RRZYb tJܷe/G^КKj2YH338bHhn,I%X,>30a,@ X .( xϩ/@R"E[al 2aA@ İ `%m[IkRk+ryqng!D;$98%I {ER*tuq$Q}*b,ʳ_bLZVV}m\k+O}l{B\*9zA-u"0à!j14pPO'Af|(X4ni4`iIij8e5wVѥW$fYtY5;31M?M\L*4*홿%9Ze,Bѫ[m/}=OD ձ%rAVFct"]&I!Ǒ>'QM_0Z0-c/n^rɣrQKZ^v΋&Nt?]lI6-a Fw7xȖqdtQ;SVd%ZEY [e{oǰTMnԡJRMJ^O9i(KX>PфtFb((f````bff q^7Zuٹ/))\ cRX0/`1^ǕI gEV \b&,d GI_G}orS s:Zk g\E.Rf(\PX.)ֆH4n蛣,tM[ѭnb[`¤:™^R! !p((bam8ߑbgEߒVCJ>Xm;/7RűQ7Z"*p~¥]'u@h%ӥǫupL(XuMxե~exAJ+VhNiU!eڲ^|"XCJ škF68,ӻwTF2.`3uHFH}52%5$*4İX}=M,]`  pY fbkI[Z[؋rJ8%|L "в3a}:|^(jJ: 5 qG-v,c~zKp0&yISDm\M1SLu6GM.#\ZMn HFz6!kYEyFtx_q \{/[62sY8K %zE|eWCF3%K,:J Ƭ=9e6ĆۓΆMTRݽ7?' e G0Z>jE=lLkɮQ LrNy!X5 ŠYEPCBUmnv:o>MhgUȒ*4d\ceU)5ھKሖEqg/(4<bm*K&bim,~oggJKɚ垔5rz{KWIyD=J3R߰Sˣ4mv3C q44kkjzIڤS\㑵xl],c[Q*tɶ68רR:5@f}SO`c*PmzX)S>`f+XS;F.ͭ~./dT;6fs 41q4rϤO^/bM5-lQܐ F&|`b 310KrHZ:4qشKޞ HzW}Kd*y,6,Cn08nxx8EחgwcT NdBٱФ,帀%vbϯ[Z/ȣRRTh-\W"8=4t6rvI[3د-m$ۭ xnBh\o*?mve*$IyE#.;qya/jfMזϩ*2n~fٝK.hƼ\+ U9,5:J" f-v8\O,6mï^|F '*f,)j4T|9>Iq-lϔ^R(ʹ$bGkDͩƨIiQ+v0#5ɋd5+aѰDQ+51!XRQ3#rmSC\dō;W>5o.EM#;mvcR oUS2vT|6GcxffGD(C1Df !((``````1˱-Q+GZ3TK\xb⍌Ա* XiSD &QLrc 49! Ff9Ih8+'ȟ1jY،-v Vuu<=:YXLMc+ے Jm>f NޢgecFQFE)kV+'yJK%oG!J)shvV:}jCUqNAKwM1AtJvlwݓBv8Iw.фuW@?~w~tɺWf Ϗ5花j\Wߗ;٦]||V"RYUgo$kJRMo>~O)s⛢vi乡Wnff#uc4iضn˫,6WT- cUVQvݖ")M'W21_U4e߭q3N\Hrw6UdvJj-VlflqE3t=SCF(\Tդf(BޜuUPbâH8f+UY|v/FwjJqFj`q8G~txXQn>zYFFMcoTR5RZiBNjjyjVV\yfP2eף—'BT]㠐S/jCW i5;!Z^ ӽp1ya|NNTj:pER^P3Wd uTˑգyA[o'FfmNNY']v-qz?}@ԥ]5H+ǫ%R:Mӊ׊ϩ;LNK27v".Zim*FdN꒴Rr>;gv!*+۴[)l%Acmv8G[4K 0"Gq'4@ 39O>3+y>\'Ŀwߤ]G-&(Vbn"@c#{b fb\Mݸ bwfz ӎ\BsiV,]lXS;WUS2\ Mpzwc%A{ J~V͡Q7Œ^D111-U);/QR K(b yr~.wYymdv\/ko>oO7xB1#M$Z[/~CX}-~J<g7-m~B*zmPx꯫E!͙'ꊶ‡'ggN\{0.qUާtc2*Nf" J3jr=Fw*JJQ#;*ϗ>Z/z>A Ks\1ZjeS:pK#^6Rqcޜh\cC*ˉFIعQԑFN1w6VY(-_YƢ^40uϰJ/\YM5$|Y $AqN#f$yEp/qP!xX m,XT44j՟~ˡ_h2w'CNK^Pq.K6֚85k W.N(JO},=)nMB7ؔ+aaMo)'jkSavI౶ dYN;5iOVL#OSC3}]֡?Isfi1Th:KRjϕ"B<U_uOCFQvc\3U7ˉkxSqd)nr`d*SsNn nCmЧŤ${u4۞ׅggt~Z{R5e!fn[fބ{N^_QΤ!1wSr3m,1Qn>Ѓ7Y"XAD|"{M9zm3JxL NGمxu%NZY"(NNel'9Z)7kމ6KF>6%=[lYF`>W%c4]eLr>U.i2;ۋ 0C4"EBkbh% KraZ .PC+@F4+Ć5OC@ڞ!(g;wϻІ+IhJ?N$N=03P1O)(```````` f `!X WcĞ"Pf()nU M"*O>@/& $-ʹ,2{Il6+faal:c3ֿP& $d]03wD06.5<7'HYM3  qVc[qff-YfEY94 gЊnQC0qr$t,U- & :сnPLŰ6f1)RP]cdRN)aUijK2Q]bԧn`5A!Ife)7)ۡpKFQwWOAbɫgXRı^/afI Y:삦"ux4y[Nta"̕bKl՞Fc'{ؿTJvY^Yܚ HCZYI֠:p|ƥoU{U&ӫ7lKkKդ$QUeӟ3u'3&q|Jc$驽y'>ae}ϋ60ܣN\7QNtJQ^ Us-dG<e\$']jd19Ǥ-)FAH7F\[31FTfmF]\ey7Ͳ ' ~ %=YԒURr*RՃXIUY_AYN2biIKxY;^S1^RxY lQ!ws KR.UfӾI"aʯ| d M؟N4Y)_#F^+VfuU&\Ybn6V7ٵc!k-HҹXnNsHWA貞*P|,55^=J d6 řRe̽FThx)$ZɎSbBSV[e)Rr(qS-ڡc[Vo>PAOs^glj&F);58 [%2ybd'vq5rIU!4!jXtKiUJ)`$}eivrF- Jy̾r:||p=\V/ Zc.7EBhCA4@O8MnfIOA'Xh$ꔗ [TMޤ-Λ!vvB1If9d#|HY0b7`1zE_1v3%cAcl[·p1JȔ9\0I7B:+XqR"}lh ۠AT8t!;$t6?)(````````` (bf6W`ᔼT<j⁙BV*Wba>pugڰ$a=1njd{ZdLFKCV,,Q a D]8tư&jB6¨2M31%Fək䁳1L]H ϐo_(X yuiKPiK&.bpM#[n֘&, z% *bO/?Q$wkD{%~S` hVS]j-LũK{-j~O\eZ褧aR-,Dlk>3QG=ǯ0(7dkF9./H. %s4'mn xRfdԬk`^<؇-r+NSҖ~ߚQ^KC{8!BNIY7)lƒdi75,=nƾdJVo^sj c24l%\lӎ#k_T/;~_hG5%,:d$&NzzHF{9˒vL4D{wwwZ{R_)a(=k[$lD,W}tR^CcC// wW}8ѦK6S]T[gE{7{ur:8qtF[RɆmo4S(&Q^.+w#niv!!^lZBI7lɴ$ZRFb69'^w[Z," Lm [!! 'f$,Vv$09vUdzRG2 >,iޏe"*݄S'|vgcEu%w"YsV ٔ[2~5ZbCiʹ &#cW՜W'f-PٽHFiaO-6RD-fjVY%cٯ#fCj_Ymcßٯ#6̵ZY"o k[2Um,#lۅͥgq0e#̆1n#ef wP.%kxz"ltiNyE7؇,%Uefqn.RUZk?+aj=UnlΧw7}l)ژыkH~^F'AR.fRO(za*wIc0)bhŋ-䲹N\,Tz,Ն1>a#xVPVħ^UWHAdy#` ڽr0h'q.(!4$3:-0(5Ĩ!aA TY(T351Dr3z4"R1B:eg+.K ճ~zt$ʯkQY0bWe8bc TG!kneБ)Ǥ7^e55=wjTxWs7ru55ĺyMuҢ^L EVcVCJq6 Y'H rCl~ī2К5R HL%m ^>&"'E4! Bz̭udҊzZj5oPY}K8dŜEbI=VdǕ J-ͤqN —:wAkhOh4GUw'vۑJIoտfKia\;#F!nV;C '/+%Gᳬ8A04a^mphmBؑ۸wEcyPE, bW05%BZ5^ͤ5fBXmMj]E(˿?ɝW-KcY"mS (я <9&vLl(%n&J-Ef3,j٤%*y=}23,"r/>Gf]K̩j&NJV~ Q-Sj;ρ1kLM44iqȦ^E!)M7t]ڂԤchei6,f`T1jvOd֔v+_!2%*qwe1‹^jj;ZO]vs%̦3e *NŦrɮt&1GKbթN+2\tiJnn+uYF+Hd4CJ3JKb˕9T21xSw4oVWb^I-;Rc{;1OVFNfGV408hV(cR,IeِrQէcaGz#yG.WNt"i"F*m@zM1!Y $V'P3#rDYfEIbI1o(XGQʦsަ;6rn.n*v~DTj-V3Fb$}Ŷ \̉Px{.D_uh\eww*M{J"dVNڢWՇE9-}KKX*vӑ˱z>-;M:q'x J\4ZWW5~t 1IҘXdC;|87QV ef>Em薧?O'e(~S<#JM5g 2j1}\0qQ7pUE*POY}8!.1J2Vrgm=O*qoi^Ǧ˰Dž)lvKG %|A)8n?SQNIdyP\KƋ]7ac6{y-E no@ :tVj`l%2.<ˋSTҊVKb[ ^ ϛԱa1M X`c%&Ө5.C*R]%9:"v]r^31ıDp;B(jyuz;y>lm D~Rd1-Jrm׭,B]ؤKkf6HGv.wRuQTW k0KRuϙr02A$9Raű>Ȫ\U!{e9ԍ}63CB/5P(݉fH"V3Ih<璿 ; x:%f*}cHe((-H򝼦pO1͋L¾iZ^) C0m8I'w.vYMY ډV>z3$GCi+VFa |MJZ&-Y 2JF{FV.6T]Jw5x$8=00b}bXXXe/vK@X,(`&z#0I;8dYv44 P3#ǵN.I$dunj/*|vڃj vfx}1bҔe3y(FT,g_af(־ >gqČ͍%#$ЭI j#IZ3plŷ3+c1}y)`6eO.ڵҽς_)׬$(EF C5=eN<5(F|d fUhIigbӛ~kPJ…:qR1%˴Y K/|uIM^Sm17e^Jpv$Sql [ ]-wm.fB\F`*cJgzVׄ-ֽ"a޽&7 '~e!$5"U{rE&vß!#EZ+7amUhi֡/HEV^J_Fw Zx1AY>1Vb@fff` `!\.(.a8QQ~aǵD000J鮡EFd8dN+ N?N$b2:xد `5j'8#L [JnCzXdߓJtx'PE]{ŞZ927r&*5u}3g(?Dӽ Ө&n(kG:j;EE IgdhqGFR4~ŕU/>S흸t|̤/F햓Kv$:6=P)xo *SvޖǓgg)};EZ_NudžKc ۋN~β]zBR'X4:5C]5׿u`d\Wq*ԑ"~1'ݺ_`@f9(\)ldI1t2}ԩ5=|Pʍ:R^u;VK'WFj#cLJaP0w&L0XWy}HÌ6R.-bqn1 \.5!Lİ3b t=]\''sO(S]-*]ښo%.AWe{ei.:p W%o/SG ^Xyo# BL77(IꉩSJjWg̻x}/hISLMHIhHlJ[⯍/I?OEi uZzGG⿐–2P|"7J.xzQo{w^h%${q%zxTFmqW1^dJNz+(w2^AxW0Ƨ}v$B$O0A788 )0k3B9fXE%&D񙗘XD.42O? f,Ac]ч_ݑ}? 4jasDXO{b"f_Fw` !BN"Q%IhĎPP1Q jj*=^ɘ f .%G6<{E<{A,P30l h& [%W/O++%ӌ`~+2w{W3i/?Fd2t}]Q!v^1ZnrLf˳GVfـGO-O0).zlrA6>+MYF)wmT]Fmh8lS%Y7H(KPmJ~%Y,E/|xAF,nFIy_]BHg endstream endobj 391 0 obj <> endobj 1 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/Rotate 0/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 2 0 obj [3 0 R] endobj 3 0 obj <>/Border[0 0 0]/H/N/Rect[80.08 34.6778 202.015 20.9058]/Subtype/Link/Type/Annot>> endobj 4 0 obj <>stream HWmo_1(P4|b;>r8Ś\ɬ))+%);<3<:yyr~6X/q#?|j z3჈\r3 gӀb|-  ?rC Bs/wwwN]8,Kο<>mABb 5n)~Sپ:3π[  gSX*W2U[ \|j,>|84;/շkW?~K(vnq?qQPTW1N pݩȲ랫cW[':giLj^-媹 J]#Z#6kκX1U>S Tݧ;,\xNS8.jGjJu,7l,'N?L;J=NTA4!ظnm_%(^@&E_tg}3Ll~H]JFyv~&LӺOvsYgmk"NH=7N}FOVUF(cPYitRsg{4?p酡ļ0.> endobj 7 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD^ | Aa 1!"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?p\. p\. p\. p\. p\. p\. p\. p\. p\. p\. Ń>_:=M&S[ykO0L0L0L0L0L0L0L0L0L0L0L0L0L0L0L0L0L0L0L|`5uquu#>u:m ^ΆkGXsjC喣-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-GƬ5Pp/_O[t<\oZе:ͯw[OgF]HZ>r22222222222222222222222222222222222222222222222222222222222222222222222222222xç G={Z=]=G<^ηkcu95>r22222222222222222222222222222222222222222222222222222222222222222222222222222xk_\:nWh-sQ<_94޵6q ;mcAz8FaFaFaFaFaFaFaFaFaFaFaFaFaFaFaFaFaFaFaFK[z h_ux94u6qjm[{:/+t].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt]xih]wQjm+Sotux94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94!d!5:OS]utstux?94uvq;kUh꼭-----------------------------------------------------------------------------xij]wUDj+Wotux?94޵vs ;}cMkz8!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b#K\z4V]WI<^ֵ5'kmY^959c9c9c9c9c9c9c9c9c9c9c9c9c9c9c9c9c9c9c9޾= ]uQ{{״/<\sZӱk:{ZokB&]HsU3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U3U|jUW {]vM=W<:} ;ַ456M^z5|jfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjfjՉJ"=~׫km=+\:Z=W>^Z=M'.^zƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1cTƩS5Lj1:W]qitͯM'|_/|_/|_/|_/|_/|_/|_/|_/|_/|_/Ʈ endstream endobj 8 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H ± @ >SdOJq CAy% HH,:Rvt`OrsR޴'>Y endstream endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj [0.0 0.0 0.0] endobj 12 0 obj <> endobj 13 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD^ | Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?C `0 `0 `0 `0 `0 `0 `0 `0 `0 `0 |>_:=MkSXzI$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$z㫨>uG6Y6-/c[9u!Ԇ-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-gƬ5{8u=}~îxj<}fص^ð{>=d5|lelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelՅ_ g(vmC5QêWx_l{.؛"nw"~ϥ.ip\z>^Z=Ms[956WN:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:듮N:玮\z{W\|>ΗΦc1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3|i|>Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&H? endstream endobj 14 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = ߘ4.GNECe% H(P?.de3V=Xɒ礲MzN@_t endstream endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj [0.0 0.0 0.0] endobj 18 0 obj <> endobj 19 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDDr u Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?}p_\`0 `0 `0 `0 `0 `0 `0 `0 `0 `0 `0 `0 a}0`>s5$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2_LWZp>GQhhl] kbuͩg)k>%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%g ({>=eq}9h} GoZػγwu}k>]H[>%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[}%l gç gS]6l-sG`i>-W9:ޣhX}oczzβhkSX/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^Ľ{%Kؗ/b^ZŝmsYt5iDhmo3^t>MoZzPS؆ڞz۱FQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFQeFSk͈MsYzp{pS56;:.XL& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L/OE׵dN"6뎾>MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{p{zӳMמ\M^$U^MsYz{P{0zӳMמ\M^$U^MoYzpSڅڞƱ= oM}qf3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c14={IDimo+Wky_I>MkZz0[S׆ڞ;޺5,8383838383838383838383838383838383838383838383839kήqDo+^tuW_U9ޫ-c]=k_v"."nܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙE}r!׵͋tM=Wê?9j>] Wg[;ֽv".hR*ɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫW&M\5rjɫ]i5SOKb4_>zGIˣ>MM}>ɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ5uť-=|z#Zififififififififififififififififififififififififif88j꾏6&1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#b1O؛ endstream endobj 20 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/262321004V0B##3= RD\\\!9K3@%+  endstream endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@G p endstream endobj 25 0 obj <> endobj 26 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@p g endstream endobj 27 0 obj <> endobj 28 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ ^ endstream endobj 29 0 obj <>stream endstream endobj 30 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD+5"   o!1A"Qaq2RB#3Cbr$45Sc%s &'()*6789:DEFGHIJTUVWXYZdefghijtuvwxyz!A1Qaq"2Bb #$%&'()*3456789:CDEFGHIJRSTUVWXYZcdefghijrstuvwxyz ?ǩ]RƂڜ]UTsU]UZX8U"\q*T$RWJ]MȮKUX\/ITU=:ew^P.ǚ P7 @S(ג3̫zkPo=:/UϢ5fN)|dt5CL45'}R+T% hoP lZ,{U8#-1hD[}9>FXh48JEq\qU*T8++rjUA%T$UUԮ8檺"WUJRTRTRTRTRUWJ*WJ*N*]J㊠<;GRQRTdN."Ƶ^ɓxr ǀu:4]B¤)v$irEӻGoxݛ,Үkm-C߆9K1i7ٵ(\6ʍ!DE;6ԃçSƲ$JQӒsȦJS"Y6 oRFHq=RCz9pnhVji*֪퀪Wr#%t渦 &-jJ*H*]J㊩WRUԮ8ʩWU 5ͫUZZJWRqī8KUVjH:u*%N.U ]T SnyYV8}T=lzjÔ:U:Q\{Z@h;),4jT2[=Q\'}x<4Vb.Fu!2-aj8H𙸓Kr0CV*ҒWjRJ2- WP2m .]mkՒkAuPq5ݪZDTȮ* U*꫉(UJPIUUu+*JJJJTRqĩRqĩWU\q*T\q*T\q*T\q*UԮ8|f*^EC ^ z 9\CIICb5 Hín=]r%V@{huLݨ;ƮHʓ\[CrRx}0A+oQp Yt^]zaUEJ֝LmRT *T9* d, d]\AQݺ*&6jڮ]qĩRqԩRTXv8UڮIT:UixFEmCtM9,棬8ˆ@sUc>e^^|3 !qvFWa^R>4l[ԍ!426Qx7Yė%r8%ֳp",lƺ1U؉f(5·֏P[:Xv*QeQ`)!);ثgids#lݭ[czp:k1v] ㊵C]Z8XR5ժq&5Q1Uk-Ewx8TFQ†k*W5Q8ĕU]T8楫RJR**]J㊩WRP5RqT\qU*WU]JJWRqH:n4T-mr "4r']7c6' !bS2 \kՔ,gT %Q`n7[^Be"R8EȰ^zcTOYլ'zx-\kc6Ouh1fiI PliX'BŭsrI;kcV+FveYF6%6>TËk8y댹ne{9/]Xժ Z}KWsU]Tk9Mw\㊪"Q5U]ԜUUJ@{WrW"Q:ꫲA%TRTRUWRRqT\q*T\q+vs8؛i箨~h`āC}Um7k.g&.p"1:ƺa\{ nnqE$JJRJRJ RJIRJRJ R65)cHrbFR3fX=Y;SrN$E7{zMlm F,Bhse7I6:vVHvI+wE,vrRr\Vn*A,9"@>0mUX$ E]xW$2,2=&L.˜L`e$v>Y~S 9%J5)Et^#=#( KߎL j[vU&H*݄htp(ryy?ΪS1QJUt+5UJjWVqī8-WU\qv\qU]J,<.;K "n27#Ja~O4ّo{zÖJvEOoHH0r!t4pTh( _شݝ'ְcD/H9d▅ZUڹY*T t* o%J{}"].W-2+9?Z5^WCZWb3uuUĒQ5uUTj꫎85F5jꪤU]UWUV꺕ޡ5*9"m\IU*TJ*WJ*TU]JR+%pѬ+ m{D=]ub+WJ*GrFC; Xã'P|֪H) oyjBW=)lf)Ft-R8Ri2JARTRTRTW\qU*UUG6UT8&J:H& 3I牊Hdd[!YLd ke~ ck$GG|٘ښr+KG-QZ%QbUUq5+UWX긂TRq*T8*T8*T *T$M"FCk`WRja骠oJWABIhwJ*¢UTRqF5Ѫ8F5Tjq5Fk95UfUT\IUUU9]ZԮ8䊕u+9WjĒJJJ.S:qЗ;yMJ::w7/;vϕu 묬5""MZv U  Ю8Y-ݫ\mT/147!ŵpo7J aURTQ TjWpjuTk95ujrj]UTUUuRԫ8*UWCURq$8V\qUu*WJW\qU*WrM'q936$ԘFDU t PiYf?_>vIRXV 'eq<q Ӂ&,y!ӄ]jz?| ֱXJ* FR WRUԵqĩRqUԫ8*WJu+*]JCxcsR9IkqPf*8"58檮UԵqĩRqcl̫ nf@& .u,/fo=5Y;x0W5 : Ưܩ}QаgNMϊ1⥛%kme'ݵr<Xv*rsߵ~:`W<*9~S8qE]l$_:(H f ֌A*hJѾaUnY2h'&Q|.VRurUؑ} #%XA$! ^E66:[:tH27p]ֹBLtxjE"\#l:\NV³pW,J.M5BhO|ƻo. 5[X!3!sK(:^ֽkU8NZuwPei)Y%J4\dA^9YG $_UAUVpyTtJrg7rJ7~뮳/Otc[HX>o#Q]C;eCy_VH(4/ʒQuЏ-f_Xknk"K:eJkJJ-Z]9E(O2V]}5;k87N#Dl֛>ԭʱj\>$W&7rm>cE8Ůԭvǜ H:MuLG3ZhqSvݲ,,m-g(iEUVk-.Uq]ԜrjWsRqUU㊩RqZ]UqT\IUu*WUJRJRq8SFCgs(«9yɁePKUԫ ÅUZ$ӽ=$N-I:4$N36iZexE*G n,[,:j5[kGK^Jd*]qZ]J㊩WjRqĪ\q*TRq*Tk?\ tXb bɵV赱ZNM$!yFpGw)yL^8䍗i\"Ӹxe Df(A]yZ%'DD,Ό\v oX}++w ౉C {WC_g}kҝ溬J"]b|$aڤz-Jmv9wNV-zᶆ&Yդ*.b\[]\kV1wk 6vs'%DչӃh?֩#`(̞SO7x8ahbы>ouhz)I"r VD iG"ѰU/ֽײGY1a"Eݭb9:R1lXS9EJu̘e0Ȯ8GH+pjR,A +*rLx6ҭ3[e9US]!T%ee}a+7@FukVkKƬmrc#KMW4[hͳr.EƠfMps `FfbA5Qmi ɵ$ܩ,lҎvA܎Hxȹؤp|׫= ףfV>]eUVvsCXVPzEL4)Ζ:3tM'bkƋ99cP4i mֹn5׎  x4(h·.}RN pxIvuj]ZUW@WJ);HMn(0\x=呓#7guIJ$H]Q-JmȰP@.k],Cu4ZFc1x*%)eƊpXOv wV~%&xBSwX#Z櫰]NnS9YQZ;p EGr zhT| ңUѢ{;)XXɭ7ԫQLUUWQkURqUUuUUWU\qU*UWRTJRJ㊩WRUԮ8u+*ħ*D+: GH:iw-gW󸔬jkֻR*$so[%J+%KTRq) 4mhNbhFτzm*ұwIkDe*[x5Tt-D7ҵV+2m9\*DWR)*]U%JP tzNN5UZPnjix6jUԢ-RR**R4X6EmpKaܒlFt̃3Qmt0G41jX_E8Ŧ$YW,ŕZja^wy$9NLRgLDF8$ t m֖ҮbkzJ\5͊YҪMU=8S<' fumA馎:st J =*|J+5ٔ4%X],Ha,-"l8sF`i:v2)9G2-=e=×w- H7Ԛfe -J) IՉUj.˅bINM 7җ2mcx#dJq̌ /'t'Fq5$ظ13I劋 ٸUDrLE R'%mceM\L"9Uߞl1J+VӶb r[@I=I1r !nKXoꡍVY'[گh'd݌aTJRxy6ͣZTӠ[f,)gR8[xþ 1,D@ o 62 /yrFTeј( rw p"o6SKʃvc>],MuΧz녛d^:! 7<ݡnR+XO+zg ^I.A6aொz w> ק^fK>9mL7<~khל: m\[|(iˆzvO>+Tn(NYfܒƸnL=U#j'"Ѱa2Ccpd ݪZT3+J2O~|}䚞挋"3u>Q;'IEj*TPNJ8Rz J}rIsTZp'&QFR;Ajq-oMT溪5ԫ\AUUu+*qT\qUu-RT8*WUP; q2 dk*1ʥ`堗pZ| !ń寊oa*UԵYU*B tڡE6H(AJUm-D1GM#[,/CɴsQsZAGЦ<U,h.2i͆֩9FL͂G(Vَ u {#ZXcbS%캟FYdS BwDmƨTF̊J:PGuIwLQO\:CoP=&fvW=Qvfv̲)Z>^rF7Oi`yA:v,ݬ~*xW0..mv7;J$I]BJ6Y:m'*tYģ0T:XĪ`q{iMyQ%I=7QRCxjc1&c \kU67f: U掽kYNIu @4UAL4xk #S1l.:ȠFPI \ P}v.#wf'`Z5rɴHZbkكu`beRk jm^d}KEɪfЎH$\EK7\Oadb D2^/܁q{r$_ꪓ4(%O%JrҝI+Ib}8l 1 hP:HeR5acnuF?( i"=nm鸭dIUWSeg (]ѱdRA"7.{ ic6,2z-v4 C0.;L#̉WOQ16`,T[^S+WUfŪH dr+rD/8-k M>B4l-`6TpJjU]"]b*i>z^/Ժq5^7#|q0nu40>EUm0E ZOHTN[[si4R&3:jY}ؓ@XM"3{5o;y1[sS\‰tl2_ `"㎖fmrUZU*KF>9Eͤc*WMWH[X/AȒ;FNFg7~h\ /./hh2l@״5qս9I I7&vj\h3&y5\71R:VE>Xc묵˘,i5zQF+ 8ͮ j5nݭuJ9ӋIyHf&S46uy7.JK[8]Uzt֚8 ؐ9#jۓ|MSTRV3̪JYxF3pu>; oe'UFS0LGF7-ҫZfBNvvSTyWJ-Ujq."iY *(5}U*1T/eVTjU%T8uUJJJ,P!Y6m桴l-V֊ׂLQL$O" Ybor4öfS>K|R`^q8OVUP$eC 嵺0yM NmЏ{+g*sEC9^bpzkwkrWeq'Kd}$P+\V6)6h\%lh&_ nHf6+o)+1sB@"wGeS5݂= =68T0UuW3#ͮAE4w*Slw $lRw \K u)#' i g'X$vny=Fq/-ݫ#yݛaU.Eԭq.QmiNO+stZۍJ:jm}5UQ$ KR%|kM1Jb2 &V]NQ*Y=2Hg[GeX䘸1k̨ kCBsٮd6C}hPd\mz-VӭZGS+񌹹2A*N1[ ф7TR-N6F%<7(]tZ4Lh8haYnMNt3~J6n6ӷer/0ѺIG1pk!>i4\Ġٻꬶv)5K l6ӭZ r!!Bpͯ4 _\ᗆSB7?R}nMvS,c$?Z9Qfԥv+]OվYrz994s:^g6% ܤkm\޻.-,.<ǀ\zmW\b[@r[>igXÜުZ8Xs$I.)=S xb7O\zl󮸉5 ~iSأ"Ⱥg0ymᔈ7Udzg/hA~S&ťa `0 Y!9j22[ qVs٢UeNE7XTqs4T$S V=au%QƮK5a796qv\q"3Ǿ3$$3vQ%OnD€q1H2HNhbir'c]VmӑY$H ¸1eĶ8ꈰVx|LD#S#Xq eI^Yf\bBOIm$QCDK knʾE8%|m`Of DU qL8 Feg=2]-mRdܷ#;h)+4\*mڐ;Va 9-mݴ% ( MvKKDKUuzDf^ ",r( AcdRDžiIϦ<&%e;3\T+7u/4Y#h&ͬݻE˓gw:dSIc U_y&ҋ2G(k^ޙN18eQk/TpgD@]A:]:ݭ qf(É6-1.@׍P6*1#>Qq*>XH:_AVNPq緪Р9\`5H[ ~ja8u&ުf2f1+h#nMb(Ot8]NtnO8]ģ2؝A"QW_(om.9F2 p {芀Fޒ(N4241,XrNmnD0ri%HJXh*ܜS<L3t}vR2ǘu5D_O#G$pl"\MU!xY1Υl@eFj%Kc4IeP ( 1NnǑrK(romN[EF%],:i]11y-a562,bf$ o7HaMbB7mdiH]e)B>l6֭Hٞ4g%ܞbpFSjՊܒ[$}C]UegU*TⲪUԮ8]J㊩WRUԮ8KXrTVpze-ckV:_p#Iڃ }1'R6qP2{Fܭ%#0岀Ew &yNTA \렡fW.k&g (89TJqvQGQ f,8|m^0"ةvWR@jvj㊠%@"˜7ECL3h`'f 7ku[=5+tPmm] PItQgqG|"bl{UI$9 5K[I>q;TޜͳtsK̨V^,EgK5UG,LG + +%~uoKnɡm.oHR"b^.s6νfvkN7ƴ`xLWL8grB4 el-esբU+K 9)]go+1J F>jGķ$ꚎqS*`~؝1.WpC.ei.5̾DodeO]COD`tE+<84\kwMmg<.|,bRN0N,ZP^62CDUS'^5Ӑ<^1VWF<9 /%}CHxmbfk*c'7V^+H^1GteK/vRTi:2&k 1q 8QV9ip˺H}&^2ʴNs+3cw)yEPMFtT)P=e&r96ũcˋmLq<>1zMs0ؙ/u)[crJJlwޅf6𻎌Xw _\6TŲ`m̑\(,krq?+!EL4 VӬLaU'J߽VIЩ,wgG= ]F.woQDİ\6<: m76ZT^#AEiö!u"ʱamI3N]*)_VYmH3:wWlF'j-8_"=U7UkJ8kIJk̻Erڅ$^ o;}ux`W Z~aTAgrʈ>k6u4Ҹ<ݜ|s~];葩X$xFKve#@=o磓0tDۘ+{Z2M.$tY M^ [8(Ðޕ@bm('oLal|r_{T°$hkڸ_xBGs%`ba[.'Qf 5ܓ(E6c&E"'9p8xf6rp鳬IAcwb;IAƦW¾v4wlNvN<@0\V,mU9{&dH潴H&' =2J^Rp8TZG#|f>@WZ E81D. S:\ebeS.clM %^תgźKzmNjJH2zEvBYҿXqn P-aFH~GY¨s׻_k`U9ȇT~ڇ%hlJ*` @g7&ͅ1q섰r4 kL$c!H,}]uzq6'Emڶ@vd͔pi.L)oA> _mTWvk%)cd AҷB@FqO 4<ּI2HAmUWRJRIQ7A*·phۣwXҷJl@k,r"W-uk^'a>{]]Ccq}GuF| X30˜u©{Dok麎H< |͹ۉVWfj 0;lL Fo8S3I$s'99@7ƘEI$h\4Ԓl5С4!Ak 5_;b#QmX%Hrg+`T wSY`݄Pl'n+ˎnP3y=f[,`9bQiy30EQafK$΢ݖ h:+[R(*Vy94ҍ2{6\<8Y^ٱ TEx1@G4H:6˧І˞<FL ʷ$^yNQ%+Il<Qx>T0,TB$9ϻ4<"%W]2?6Si@R Ƞ+ĮX㉙\@I4$ (䰘G u-T6|9(o0԰#EIB|qֺ)&y,Q8UJ*źDak&7- [X\&*M'o6ڊpr]#.5/J wDgln ,-}uj:B!Y2ȳ,=$Q,*4{ZF$[m;ޭaٱ*m";MȆvW9aKVvRK`.47 ) F{Re]牪n(NeY` ' |iam57X$AȾw Ol #FuV*OWQ4y8܌Ψrg,nkk\Zä$!2@8[k5͂"1i`C*Sg :/#&H8x\aq)xuvP<%*] 0AAx q ÷H3/37}HTQp~R Lȭ W5by0քQm\E jefaEb:]; **>RJNu  ,2qb| h_{ ߵ $4ʠ0:Qm$;C.], w uް86z1v7#_ADIp#q|\r6[xæ&%IEԋbV`0Mq3tBz47lOMdž0B(PlZ4Ey CPI][HiӓV*D;6[:. kD DZfF']4\|Zƪ hK([C ,ƨuWj9I]|yr N]FZЀf}B;6!P4Qo9 :ψE"!ߏeswrGC]qRtϘ6TǑW 򽟉H ;uOQN=~yNл\!󟊏|t aʦmj2ƣ2zD?$nywXv>ׂ3FoƫRV@a4b#OamQꫜ[^Q(u;ϲ G{zaȺa16; )s}苿5hŇ`LH]V̍[uEݴr; ]KVqU-Wj -]ZqؐU'~YRFÃfe+?#T$rSs{tTn;mrjK']d66(9FSؼn1lĒ7m7H-u6*YI79 XY+9Q|ѻ4I)d8_uPi.K'<l/keV] .'bU8vqH.Pl,msrH8 XVYsѡA[3ɲ!N0B1+rV<spTf'l 7ؓjHD F{KOʫ)9tXf9?s$!4k_M+. qFVf@ln4:\ p*9OpuȒtoQ6U0]VPbh /QUI( }3CꅏP F#f4'9N Y|=uʀXǾ[酻qT́#r2 zGe+2Go*F'xJh #=I JroӦ="' F{@8u| lEJsxGV=\J7VO(Eį ڔ,1HKaW51sھ8ht:V.+26 7f3Hf,IJ[wULJ BEtIP&hH(Sfcᢐ-F~*Ӵr"yEC}4,dsd@I71  2,WxNGfmrI%]UXUpD$ݧv=6kU{qP6>[{Rl#e*:G,^3UTq̈ņ29cuBY8ݭRt-]C?Y~MaeĈm0Xa+'%1RlwRFNRN6qVvqMhVO M +\l̪Unh+ŁY_|1p2S}A; ;ǜDO<:Y3]@7`7\oU. 7c\AUU'!OLwF[]ST뻘xdVF1,g+oet0 j"|3ll DͯI_mEVMkSn0[z~Mݫ%uL# ǼWByFaF;h?mr66,)hAB^dQ}C]TMd,1FC>xOmxč?mO͆4%GGăڢ] d7%ǚL/a ,Smº/c hZ)98ms<k^rS΢;C6?;/|ܡɾֽ麻v|7 dfc񨸜(VMCC.;C>*.'=)pUMW^>,gxmoep6Lv}S{*|Ë[haܓ\ÉkN{Ԇ] Р_6k-Z!0،[0ܒ{kY-e>2)atWN+qrX\+rl DVy&x)J设Wj,cf2@| S~a025!7~ xƵ^y}adiJxVmUjg&˃O=|4uK_X:7ڥ{BiPnhH߭uG*|G >awt}=}G>U$G`zx{"sXK ۮGք낒'ReEسYXc&Y)"U;QmXrVҴjAFlX<V# ل<+l$k H2t49e)qJ #ԒnAslqŇZ졁nniWWIonC)ي1WЕ"@۪c~Qe8e!@CWUk -⚊j_j'F|T$*[ mKD,D^+>>ET# yIb'Y #rTdl8El̨A+WB309H݆kqHXd/$dīG0E!_]w5c"ȡ{+mOU1[FB`G8--͹S /BEHQauڭJM\(mE{Ӥ3FyPʬ˪Co #2hUn!p|ӈbgEȭ,(6ͥ# P!1s:44qMcGF:b Ui[R 0eI'SAHv onLbecipwib#* OHZJf+%]J΂׹6s\qyd%l!Q|ʼnkAlI2sjR'bq(y#ɒW]Nk5i_cc$ԟ0YL$S-q}I$ bʊiERFkiăI϶8DE#1k 1rb[/xY\-U%OBL!9RwEnۛ#Chp7P.XuExi9Y#*-y']2곶`nz;5K9I֍1MӴ6 TB ΚS8H X*Hz*9'37"K{yiYTcck䣦NI9e-hrb2F̱2?0J"'&aċB[ >IHF3ik8B4 CAK"ڦ;e$x18N# h͈r SH|ƍjc%'HNj<71'%Qi]l' ɦG!_%X w1$jRzxS0v,V2ݧK628l3b(nP2ۮ!:8#Y]zmSgɺMS 8s:6/B7NOg'o؇i<=B'ʙ|"+eZaJϙ+y֍6FbӰ3I)dh4l\Xtᶆ8VԒ" 0 $,3E:顈 ПPUn\>UwX=7";Kj 1x.k o*x7"rwdr˙uV}cI6%H(b:(|r?om{&fKo5w +ƪڪH'mfNZ7S $gb3bF@i$$WLJ62*/c`+LjyU3;mUj" X? xO}Oi3iEp9ok2 T>KFqa17(3_ lughPqi+z/aRêQiQhm> adH;֣2w/jJz$y*KqkPB麽-$!1$̹`05G!-DqpPUbҽigOE0 &XSVGETxcOt3en7T6s}!e;ԟei~޸S44׺'u^sv3,atN~YAxT (jno|oA6bf, _ĨOcc1 u%XbųeXeklH jaqbovϡf,llUM#FB N=5߹1'}F\Um84pW3).m{ υ`o&%isxƷӬ7&r %@Aޤp4ku-#CrE;V1xD P؍A87フLfkUQMJ]3NIgQqo^`lqĦ)cKBt}3`sHs~pjkF08be k$8h79f6`/( ;^V5&Vl"d:+M4YU'-[z cA% x1KHBo#Q6d_s '&-ۼ !thb+l׾I1!et1dFbN/k B.IB'7-\!hӨ4`yWbE6xWɇI2qj:d#NoM"ص9|)eaJR&:-쨣':l*UfCZ07V+`٬t+(ȍ7~QArOxp.*|.v #7m熭jNNROVl>cdƌixmA|& PphfFk3B33 =><  X{MtrFunT&Fk?_~z)ȶt3hcf1R[\YhP;H`/Y;d*mf(k|1gy8QxC3QF<<1 n6T7fmmxWcܨ\C :"jvTe:-!X ={S`q2圅'zͼ%&$HA d]NKq>zX*:ʪ3s>e;9AC%_j%.f7[kXmK\uְ/ӅnX^Pp"4Iq"HDj7ŭ_"԰]RIsm6h4c@@U.r7;f`,elU"]UEkQX-*TYwr UbIeVe0')p6ffNn;Y9t9V:a$!ly({Z|ֆvpzc?Qȸ\IPFu6߿J`PYeRͦ*ϕTTuuoj1P7&aTIaB)Դmc4Ӈsٷ?g)2ˋ(:\Mŭq/TN:76D iIZL?%Cl*umbFoc(dUWL{_̇KU.v;!Yٮ24m/um%1D2]J]U;ediyWMٍ^eI.i!hWb.`mJ- vm /y@h/`uҹ8 ;bRYwלnRywf@I"LmU;9]GYW襇C>6(*ᠵtcx[N$_yؤXX 5^\@ԖjǣMlXwںL&u.IH[ʎvp@u"Uw7RERb k+(ā{e:[ZIp{*(uRǵ7=Ň 3)6lތ0xK JSxF\!,z5F/"$*G#Lk»5 Mωs&6Y\yTe' \ڡ{6&~ k5ء̷x>Z\JdvlAe,NMvksh˱dK=ۇbW =ZNtEi^S/$fYX"D\j,l:^.74P _-fAy/7<7Ts,C_^¬Fmr4,jW,M瘛#c %黦"2Q~5tm~ç%Y_y(H}a6cgMyg( EOF~r~,?Пo6PGtE ܌jeBWaJ]Lyn#$Th@c'x[D֘C"vwj%̭s5I[1S g[[R?ΚiQu!=A-$ۜ5U l,#yF F@6_] 4/{̠\f"E.VTBM鹈j*Mj"LɌ y@ˤsc}GL re9Fzs\W2=n7F|Ao[1J-9n:[W$猛q, uNh>[m{1b}UB/q!X͵7d9һ< #dsr@ޓQ^90xcO4Ii$BdRe6Dd ,xx]^c DƬs(|Aȱj<$n;wn}4ll}-JںG-'\#№`(˒u‚(%PǢ´v3 z"7zZ]];qѹ$Lg,x1C fSv[ABai{|8ZcjJ%H 1aP ۢ+#;E .kZ֮deX[c̗>Zwii']Gp%#תvj9Dm(ktd 44ю]oXnWy;4O8S!!#{- zWM1eY;L\m]Fr8ˉdA_]34\N>P ƣǖa| i+.%ّ3#Znx`0EDt65Ҩ  A ?cW +OWu46$B BaBap/k\*Bgzf;> 0t͝~,9CjBG€zSV^W8K'w!=udBT|T p:1x( f2Xy㺉ͳeoWyDKQ ySS[Hi5ݧIeO%"F"sd2U$QUuD$(} Zu@`nF9A$|1+pz0- 5Τ"誙)ՁX6}4 >ufi[ZIV_;WCD$\$Cq]Lzk4,𖣲V4lTVx@,. hxq"+s+7#HmSЄ>,!Gfo!5W)5(qmy^H4n!1Psy5l[x*|pDe`~ 9Z4dZǓ]#]',zAKqEC0\dԱĜV(9֍uvee>QӋU{>u"L mGC3 KΤafp]W(G&|{q̗<- v)ua!Ћyzr_HxF\w'I]}U(+hlFEw.T) IaISqqAH!_2mT/ ILJ_Pw6 acݽt`:l)ݠ9Mcc§~]%oU gb[xMI \I☑ضuÓwE9fpC(}4şQ1/BDZňB5Eǜ#FE7WIq:(Oq fLn'boH)]'s]TFS"v<81x1+{(m"߼W9;\X)Yz@[(H` :1QG}=tuW[¼mKeC ;\ћ]bI]ur܂kT6igFC)8$Gp.̙tu܎,>E=Ag\=ĐfQ0Ơ]^-]mQ9 ʬ@:-qX#*؀{5ẮCgyj(Y4ʥTT#ɥq JPn&}_ }MёAY:WilzgEouLdS7ҪJ1%xjkN?]  L9zqqB#6u_V%a#$)E`ʤ,GETk̚G{X-sMTZ20pt\ @F_Xݚ=R1hYJ5=Ix2LFatl;`Y<}3E6@vגּFM{/JBqdTp|~ipq "YwPRHt:[)yݵ("Hx9Jh}w+V9WM@=V>@ĦYy|ժLeT]KWU7?*6DCò@EwPzB8N"AC^t5k[9K)&P]X^aZ4 "K||a -n\a & :4#:$ЋmH#~iɦ+7V(`@@ߕLWx?c.{-bW{-UhEyYU1Ҩ"_{Cb U FoSThF5/ɇ&]olK7Ĝ{KVwb6kZvȤ._ٶ '쾺+p6fV`2)M]ڼћW , 絮Bk}ZSqrLD/ :w 71*&,lT1Hu:PGuٓ/SPɲ'—P"0Qu򀦋{lx]6"f*z=Vv޻yT>`TE%"XPzАvjt OrǐghB>!Z\Иrg!$T6:(GeuU"[SPv/G"=5o(s[KR~cҹ)Ð{7byc$ o q y% k $kƚɞldpӇTqprmq򮾚c^FS>[ZuuCmRWx?B|5pCG5#>O9oO*9Q{]`ݱL~\t ~>+Q_18 OQ)W>x:y, R/ăSwԾHd c=b67ݭ!af}‘繨ǕZl]@{b5LBȧY`ۺN.0r2160՘: FXSj|itka8f[!#&pibG}*iDcGDvĜCldb\3_s77E  (~?u'Bи1Fr< @t\yd F %ҫW"_kfw]c<+2tM*$521XAq^E5݂qb.\#$Ml.aL#&\Dg3Z T;:1)XI0GR =:=uNynEd2m_M)\ +&br& ty0^&U{TI&OBs~S$Eq0q_CCE%|@hܒ̪~Ph\aYԐ.N0VHdt<׾}ֺR m\LlzQm]"f{2_-NUmh[llݤ^zBF 5. V:(;=p 5Q({J+=[9> &]bE` ~*Cd)ܐ6U5.WƐz42[`{׸kY[Ir#nHeWځq#o]Mrr3xˉAEOXP)qƪ$ptЁa&`㶃 Ө/vf8P "˱n2bU|z&+ЫRRFˁ||DUb4aWy[O\-{8˳0ǚFXWxnr+a9)U#Q{9-]ʼn>)F  {AcWVh@:_W51C\v)»jm ǵI*$jN\ $,ۀ} gcj;ɨ.,nI4Bsmz&ZۤLO~*?$od" FF"5E\Jҷ& |K0X.ZsSgp&zq־ =ɋk#Gp\b=u%8֣0vo禠al*A;W4 *#]/P]3h<bt^#1$!AxHS{.[5bMI;\Kixx1ЃkG_H}5x&ؔڃ~xbܚ 娪Tu{0 ۍ ?\A'̂>p🼏e3 _)"YcqPQap7 Nѳ+nN>Zô-da vh18'(Vb8U+θeRf9mWP]8΂I^q&6Ak Xps(FsjoףW/>U9 zSJdxI%YtBԌȴ摄w /U`#`&$먦)qgH̺YVKfWDXwwyEs(\Tq7Q5TBy4# X(һ \Eڛ[1c9g2-ckN5Ki ;C5+~v-꣇WSi5A쏙R/$N;lwU$/)fSrl}4anad;:tWgj8sa!@i ^1q9ʠݏ tb4'AUvU,@-PatQ$r0V{mPh-{i HO6!AIm㡽JURhJnbH^0,w%[g/_6pӑSjtbp-}/%s0 KG}$q8=fa\ U ;EvnmqX@Zk Uf6nQ5ixxGQXs.GaK^с a]Jk96Q8ܷ$ fpE y7z(EZW,D ;q΢pthuߏ^"Tt͛h;c1c2W%zڎj3"6SX2x^qJ9nmLD>ڜݝ<&`)ﶾ8}&㮞o X]Iv*. Qm7؃moQBs]Hbq%r6f16QcsfqN6&Tx[@u;Qm k>*뎬3+)[+ 6wp=U @:%M(xHTUrGg +Z8m7wڙy$ԕiz+? #"=x@o;tqhr#j2cSc-rTP02?b1m>`.f}1R'"bDbCf -UZճ^GE)UǝGJEma6rZ"۷g馗g'mZL ۖ,ёJm֪]5j;>ZƾHGO8EEqRDg[l~,bQM>nU XKHAZy 4du 6Di8餄uyf9eVoV`:#{R[>QFt@  5E86V?w+@Jƨ%GKFw5 vސz뉶F:i* 9ԛv j|pќ,*S=!UAǦɁqnBHٮĩżߨd 7Qx\<͜4Xl9o;NҏIF 5 ^־Z1tru l8vN15?a^"4Х+ 5q*3̝j/[oЊ=fڻ aEI9I2r 2NIUXI:aԭH\>6L#Ftܢ27Xh톒\D.i4^fMGA-}kG ͖ԁqfm"Z(G/؛pUBWA3b$ˀeg&ЃM+Gį,@Iāq騍~/)iԏ/ac״la&l>L6({p Cؘjx_Zו<>.NX{(^+:+*`*w` Cy,.,j r)SVKn˥i]fݥGԀXt6-cqt+Im7]-^esyR!z͹ز죇IHZSjlxח4^:/F,3y]mI%B#,8Cڡsŭ1pxr"&NR1Ӧ֨d7lVTӬWXSAjTPX͈wœ'O!X$,RE*G,kއ<bS$# hjn^'lnȖ^G9ôVYRViEѪ8V.gq{9=): /@\T -d6Sq+W zI=TSf· héV  xV>ҚQ FAo Ŏt^~JL/: 3uIiI%8#*Bd"1gVRJldfR.YMCxh%&Kk}}~Ē 6$h{QvQR-5|O}car&M0WZEUQ^$e>P Հ"b^j5jwVC2:f[؛\(eVUqqNbdiHM5L 5dŻFF4PC܋G^y|æG#hBkڪܠyu {SŌ.!D#{+ΊHuʑW&f{نus啺ޮ1ذ#0 _Zbh_hՕ;|]@IzZ5Xw٘ʫfRocѷȾ,+{Cb@Ex~׭ cS,P#`OŃ v>uZyErAV0';:X>]g_^,1<࢖>N\+D1˗Sy6~88 ,R9J>^8($TPUvpRtZJOc !KYlKef ڝ BIbXf@\^}tHoGӧ6:HͰ*C|@*jR(ݔiZl.*F3yK { 4Qæsf2vVqKB(vn3x}]wo+ TR#>~z|x;8nçcfWv?)TuFt/P`0CWc#k-Wj-Hl%܊;Ux@ړ "kڼ؆DlyccAfr8U[t A%Q5o:^+w9[>LXh0D]wD/-mDz-V[bq7)9a-Z֯9' 22TZ>+,U8ݹ<0[E7iVJ.yWqHԳ1\+vt<~SY)fdtٝH]@FlDmf:^ g6~<\F:nԆA*TXhcd{Kw+rNQU"@A]ޥJ[L. `qcz2mi&!UK3.MM'VC&($7*C$rpvcOm5CEbmhxffbK17$QrIo`l)'Wl|1F?Pͽt^oR_2*мwj>|$$ت X~Kj7NŎ[u^T&h.&'?E{Z":/p4e|ٰcGT mQs7Ѵ0V$yIbf>SN,fRAkq(HHIF6Ǹe1;]36&ǣ \񢊥Ir#9?y4 H5fB5,]qatZQKc6)1 ,ܭ5r7SJ0 8QVK+s,rFWxؒ+sbJLN-Y؜Ii}n#֞[05i~ܢI]ѩWz-LA] 5T JAcP1Oĩ 1<0Le$PppTחiƈ$GݘiIrm8 ^U3UԵX88 ==x.=մj^V{1=x͡|f)E̯dhrek*aLIqp;ϐiEF {E|<؇uB.=ﶷ`KJTh^{-BUb"׸&#J)Jp-]u WVPu WWjmRUq*,UDc3vQ&GuzT3y9ʁ2Upɳl=zPTJ7&RҥJb5?B+Wލw\qtҁ fwK(75Mj)ѧ3;@ 6Aע,AWMj#NnnT]R VaWj89ŹZӵ*%6V\W.,H9iR*\mW{*vRTRUԣPW jW\ RIju cg䔅`vuaFJQծEZK^oll!dcHIskEQmu/4֍5 ݪDAUʪ^ FAzXmq ]p4Z-YQ 0%uo!eIA>HaҁxOj[F.\9SC94x\Ie{Zqs6!EcG{4%vssV oZWzjWZTq6wj8]@9TAnOiIaYV0m7[jM̙fqc 4H+LX1bHRlչZ:v#%Hu]bĞ1 dXlڢ@ZbnPXV}*e.[[{tRIc ):֦>LaXWֵͯ~6 ɓ,n7nA^,ؙu4F]pZ)*X7*QEZ$ccl|g`|UwL4LUy $QW`pP.u#F H mWٹ<먙B9ukN\TҪj1SU x4,6"~q,nt5Ek9Ιj+52j]H2Y WZ:j :a$W5w8uY :N}=FUwCI42@!HKwt^ KMf7c䛓~9l_*‹67t`ZJUJUڸWj$UڮqTW\qUUvj㊵KUڥqZ]q6]ZǾRsEw\qͪT8*WJ*WJu**]KWUUڥ*\qU*Z⪬kT8vR8-]Zq49gTx҆)6K.-ZU*RTdNў"0G(>)O ؓse:rn;]L>,bBVx\|_=VbM t+ SSC,;%$z=" L)֪+g``85,5;"#5 t,g**SYqs\3Aᘑ4F5sJUj.*u,jk**W]J+t(iR@ ±d8F)& KhAEVMEj 1/+ 6FtMwvRָҥ8vjKxSxc%Wb# n7 7A>kW@FkiE{}x*S*m\ҥ]Z aS(ReWWzrժ] Uq8oJTz&1K[dM@3ۧM;1͇??״ŃȲb܋:kɤX\IWo2Fh1uS&̄!'N}V6Uϙ.Ha>skʦK~4 H/fA= .nC~Wǝ%ɶƜy5q;kDH"7V&#gdb5ߨ6ҝEc <{amGuȢnt (Wqıͩu` j-]Z$/neTRԵujWqjRڮKWTԮWjhsW]ZumWjv42v#rJlѫz+ٞ8>.B Sd`D 3F/GSrɈ }|l*@,:*rKuu*(NJ@_K09Mk#eC.Yt1"OH&JIU^aXu kUڹh,#`-r/] P+%U]J㊩RqĪ\qU*N%J+%J+9R= T7,&p>D8*T8*T8uU+.UV7dfΊz&du*Q]JWUJT8uWj/\I-RWMqĵKW*_Nj/1\qZqVcsq&<Љ+䶛  7UPݭtzPӫ]ZJJTqĩR5 FWu0:4G([vΖlVhy (mXh;kvd "sȷ^@5xKF$/ZF*hHfl10ؠwZ;bc3KVko:)@oK M:i,Bޞ/*j(Ivq[*ߦ5wz>\G >mkER3[k]UԭWU-PM WjUZRuuj\q-RJ㋥6'ܸe -1Zּ؋t)362tAEUzB׶ņ&EI.Yc{M%@#nok^ Q( utKH~ʥ`Iq=Dkhw'XMb&5P\ѣ[IJ)iwe} z,BA X4D|N,5&+vGj`涨&)tdQuLWO6jjl(Nugvк1j9Mѡ1]ޚC x? "6񿞴B,4exӘ֜Zj9*TJKWUUuj8UWUZ}Mw㊵U]꫎ŀ1F蘏 'fSOZY8"TUI \k\K/$$- Lv>ZƺК\JK%cپOX em35]l 6U$ir6ߔ"j2b d?T4YaR{ՅJ5KեGU+]\5uK JU*k\qU*Uyk9Һ]И2JEJ^b>7%O_U= a4|;\ ˔.2zѦ4o@ċ j5֦z[*b+ZSZMjSZLBK^CwPzh.Op> ߽gUmRԃ)U31'MNiޗ10wAұNUf*E ,k 6]}B%Kn5"uRveRqqdnk!h{/M`[1+MʭtKqmWc]UZc͍KJC &''AbS##7>$Bu)W>H|/FQYX$=R-F Uvj㊵]҆A):]%;l\Ɔo:m^Jk nl*;ւfsjl6)PJT( }Z_HwsJyEcphBmU)( l ȽA8N=pQ#@N}% =R;rUfEIɊ"| {k]w$llħ6e]PDZ"zKi;& ] eN1()(q|>r#0*wo= էJ@ȑх}@7 ]Sґ[閣UJ 6Zm+!ةWWZjdWz*WTRu+qj.t*Y ץZ 6cnOTBY["}⽭!mwZ`K9B>L d4(upA^>J krO $u#MZĖpYX5n"yev`)3Jp9;FpnQZ^u* /+N}|x_8m#&k ('ֺU륬,;49pB?mU6#]0'IOUp"e|2 Ԡ͉"fdb ]`nTϲ q*oM͛iiq1aPprB='Jm1&`xKlL҆s*&[U2%Z]՗G'+{_bS+p:Oԋϵ6UQkUp{+gؗP^q˶YрNu֫Je(9+fXŵmJ$;Ѐ-{bfץn<$|#M~]˚Aɭ-YܪٝJLFv~s^Cckh߅yCc&nS$f @mBlC\e7Mt%2O9A]-Y::RSlc'bFo^׳l s>gTLF{ؐ.7-$$#GnE–_P4iÉ)F:B bU\iժZdsԆz=4XC)%tЃ 2@7#x1 1룵tqXmsUu#+\ގ.ObJ[K,R@Ꚑ Өvwp!t1՟6)kU{X7ۦKᢣΪhY;GJYؗU7\G 6zl Hw{8Dgf7 =on YET6;E3ifܛ(r+ 8 R82=ɶ\Ir p ׆TUѧ)Y FꗮdYccINxZ4H2('VpI6W*&s}j^b%YNL>X^NۼŞ.zS7k.|ijy,:קH$.T07iQz AQW#w Ғ=UNM', boӮk7ZTCyqE:+wXg9ױ6=H.[5 úʤҌTNLS-Knӎ:J $o;Uَ$aQxrmP%dv1oP5 n(:o(ΣP2im-\<wmcM; Vz PkҺ {C򀬣?WO=>b.AuV,gjVmL2kbV11 |F&]s E XWf)hs)\'W$@׶EoO hWk U(\YGx)(+:>"9ltcKc'xHߞ~64.SJ0F ҀEJnҀ٩z]]sW]SRENv%JP_A`; 1ÌS35 rӬPgd\לŎ_ɧ9Bw5F%K4zݚpph/(ݯ= ު(tw Sk-G:_S@GKtDn±$8^d"q¾KIxdol%ƗE`o14| % 7( g+z}PrȬxEvӜE+9(OIvJ tt\k4\PSshk'17Kv) !}g,OHF $_Z]>6Ce2SI r |C-fl(4NLW'!ێEw i+T'27ӝǼR#nUDQ[*hmm7kIcSac%aⲆ@o]dž$xA*AZo(g6~.PZ׼c݋fqF&‡!|p %k ߊ 5T/uY,V*k/3F&E hp9؁n Sʬe>{^]XBrl@7')+}z `r?'r' 7CYa 6;WqHܑ|=5睳sP7'&S$@,#+6kþ0uVNbö"Ci1$sSw}jVk/Z]uD0: FՔn~ՈEd:CIuЛVZlM<2FjDBp;H4bf7,zh3xU{fJbrTK͘+u6尤v\,M`v/]S) xXQrZ\뽋c1# >\DfW1}Mn꺴W~9H3XxFmKLj,$IAaryɷ&60ٓ={i4 . /+IQ*ܨG/f~ hDg %MCC|XYĕbTbl|TǓUkkvfYcV;&Cn_h dxZW>%PDZ۽5P\ㆳmRwpBo~:W3IXYBk\2_mbFAe mk[u>l\vg6JM>;8f rv6Jj;-+|Cj$E\ˋ b~J^w@+JMy_6׿UpqrFF(s!fԒIZ*#HbNVzHj)<ȵ^Na!EԱlkG^wc&uӫkERḚΓIZ5e( Ld89$G؂饷Xrl-jh4&.\Rt ql@"&(ЕlT9˾Vz"C1t:.7iJT2,@Ibl$-,ᓔoҺV$oԜqM77CGbtX+b] W-)gb7jHbcgiAJXNyKH;:fQq( [nN'F&0m4X"hd4y9zG44OK ;`&>7Ԇ,K+ P=#U[+ kZHEEShD \Q"~v|Łdg#*-diY<꼜Μֱj -\?W 0RI]mfbo5rJ,.@8EB s5뉥aym"nR6c`.ǯpWJFL AuguIb[Yy<@<7 ,Ht)҃-3׶;jq3hʭfؓo%aEYR& m,wע<u\$4wN]%iӠik k1yŬCTo~BmCѺi]@Ұqgrq[ssư1MboQs1C[|4S%ރ^{t׿`!\,JI$d~9t@q1yE( hŵݾL+^i"zM'w6?yCۇ]V *#XRx7IC͌}-Foת|.%nMrop8褄Fs\׷XTqheN6xRٴHIU#Ъ$YB.wT,k ߥ/" >C4’'S.} %Aak~؊AEkºero֤VtQTb /kժÙ13.\=ZqB2 d0k(I8"Ės\gfabwډ*#2 QpokY+h-a[MqX!*A .u4Ju!ް9sTM뱅Ȩ#7~ho&nlH mLm!2硷W;L(B&R6^Vfۺ+ Apۉ6:M/أG/jGP-"|]MTNj9ã.BȳaLX,lAqILG'(h, J k{Vf eq`;hǐ7-}Iච3謹Ȥ3s9 ;$ IoZr& pEeaoXGaYFdM}鱱j5y`‰bZ/K. 2A-pu=>ORޕ=;՝אh. Tkiњtx@)C{mG *,Bmpc:'GSd3ɸ*h߻Fo8p j4Ԩb-"9K\:Q@2+{Zi´5J@V5ǜVv+jG"-&_01 G:J /9ўfL̖r 3'ԛn |]~XlƷUFM-THbX9o8V`tRG{=1ҷߍTa'NYz>mO Er*/4)ׁy9Yo!yiE}Ou;UnRAeIdW&"™ch~/ke:ZT/FoȾu*E͏ \|Ѩ\0#6r|u{i!M^u"U+(ֶJ?G U+l~Q³I,gqڵk<":5ymO%R " fnþ GS]m'6n$yhGOPjTGnAo)julSW#7{u]wx#zZ% 'hxBf ozQG> b)uhHtTQvW>ZآAD[PܼS#|";.\(m\qRk_%b.NO՚3VǒaD xRr׀kzvRxR}?"\+4?ZڭQJo~ObfpW-<V/(B}}.E> y[k՝ZP<')b+#u}Ua`3{}{-I@}>Z V(䐰AcO4kBy .L*ĨyDGBI=Z<ɐ7>/M‰hH"qʆ. cP'{vvxL,/ 뙍Τ}W[S$_E}NLOiK8* lQAκ]S4# } WOċ+7o'XȖ$;4) %6w@C"̫nv듸ژu |ߪw/Vp☋H2"XES Ꮶd"n@ "۵d~ DP45ɱmpZ(XrW|_( (=uǿ=*(NHbAԍi4-a{jZQŸjOƅM^k`6DXLJGƭaP|{j1nʮ&ƒ)YTx.GVg{[Z?F5Z. ɽ\?;hq7Wu6ӛhd|87a1=):'A`†v(.JyMYq5Qucj [o?NB5_/uq!gHb\EsH;.Dn>O;P7+}\Kv6Tb䎪עBrי<~{zdk=? endstream endobj 31 0 obj <>stream endstream endobj 32 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD+6"   o!1"AQ2aq#3BRbr4Ss$Cc %&'()*56789:DEFGHIJTUVWXYZdefghijtuvwxyz!1AQqa"2 #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?n|Y@OVpf]Ê&6I3`*h?3 CIZfScE i ԙ U(8'#vEZ:TMK<0R2B\QBS\:)\9r)\"\9r arйJ @rr@J @ Jr˗.@rйr˗.@rйr!J@@rJ )&2qY^eNi{ ƪhlC-EQ$G™{9F^]ؖ+VK( +aNe:[jsEqHlm>S Q uF#&C .M`Ju b)6*u `až&8E-I8EټzJ1i1L4po_p%S ow&)VT[#,뛤H,'a^ @-p"T]Ö\;U1)E $GE{݄V8kXv!l2NЉj3  pChaRA \F;/ܤ#/9c[Y`aYy>ܵw6gJu䚎iv7kXE4(e e=)ԝαܮӃ=aj1ٚjeTg!qPڮ*0vƲ+(L/Ԯ5H0*c*{ kO#C(\pUò)+pɀXլڌ  |?3Tn\$\r S.\%r˗.@r˗.@r˗.@r W.@r˗.@r˗.@r @\rW \rW \B˔\rrː.\rː(RBj cKɺ;+,@/5iᰘZ @sd^ OMs\d*Th!L0χvPU'&ʮ.9: `{jFNf[@>=(l`|^jo[H6v&K14hJ ]McSjCx 0haHs9 $jITƥw<ˋR{Lv+SsoUDzxvqѲi_C5,5@5 ɽ0kʞZU]]jMLR͢)eĻ=w @<ni ۓ6 8pҙw8h(2CU!6x{B, i!kVK82!Җk؊6IHפka L2qNR' YhsNf TbB˛STͶ fq5Z,.:\h_7h!6hZ0b"nMe@-1XRĊN -*)ĵeE980, iR 'pC*vDaJ@6xaRV!r%rW.\9J(.\9J(.\9rW.\9r(.\9r.\9r()\r˗ \r˗ \r˗ \r˗ \r˗ \r`B*#.\9rdwBch}2ã j\ %x'kv_ݫa@=W R*I缲SR9D gM#i5qs\i0tHEr+jʀz,SY_7VD[qH5FHH4߈stFj+9a)hkIMGٔh&+Q2 6a);.m0$8A3@ CxZgBVX5jF*04fV܉7zmXT{|mAߧB(`qx11vH;/r3VEb9hmJ3sֶ w#ireHh:4t*9FHV KNPȽ'VpPZ96tʼnF^-1KU*aKiDNЍ)jӪ6 LiLL;Ȅah|:9k!qR2n;C֨^i$Lz!VޯkK $ u ^\I7ԬWVoHߪ!d%-ciN_Rխ&Y96d҈ 8~`]1q S$˗&)P9J(.\9J(.\B˗.@B˗.@r ˗ \r@rː.\rː.\rː.\rː.\rː.\rː.\rː.R0!rUt{Z+\;M]f͗#ֶ6>ޕ=%rJb3To$u`_ai;!ӖJ'Zu/^c4<2yƑ2rΎ jmjvN+RSuSzt%\ydzDbbUWs+ ؇iA:dUs~H FvaCJF`Hu7RXTr?BpS6i"JΑ[*-`;4Ŷ C$7&q:pL;%0љwU@4$8Cȉi17}Mܝ޲M:h~cb B5Ži @L U'qT^4w:"Ӣvö!깪Bn @ ˗&AR-{1[fmq ) bRց shkf^(d\Qcj45M.;g6M6ESNp> Z sд\+۞A=9W)/l]GP6"F.LW.\BT)@r䀕˗ G.\J˓˗.@B˗.@r䀕˗ \r˗ \r˗ \r˗ \r˗ \r˗ \r˗ \r˗ PB˗ XT硭+uhz|YUZSs%gSؙ@f$XWTm8| ]0 +>.Yrpڞ˧ ΩZr)= N 6x9DZp+}@}Mݪʃh=ڇ$~=7 nj!È28@V4S\5ATikZ3q #UvG1ߎgPr^QFe=45*8 b#M/OkQ9Li\e.SQRb 2'ȹm#(&9UmG'`:ئ6~7=Zv:sz/ɯ(SkH\44frm'{OKB>gi*n Zoɑ1el9.aTx1Bٟ Po R SFDta麻 KI:#L57|XXXia̞bTabp.P9;Ycqjru)jA-6p(=A֒E_TXH,Ú%9Vj0;*S"#@;c*|X7>cp$5F@2*(Jw] AymFXu,8k CbZ"z8VKCZZ$X⨍8(l!U rYy3ت[hGpC)fW"edcWn1*A˗.@wSQ\H3^C`u64&K2oD8tHL@yڶoPXbZ[ԕrʉ9J(\%rW(R9JW.\9JW.\%rW.\9JW(R9r.\9r\9r(.\9r.\9B.\9r.\9r.\9rT.\)WGwAASRG t0x@ɧgT?VIQRo 4̰t*kbz]Q3KNGz!NhMچBa0C&w"\/zf6[kbc=|H-?K0<kJ 1R )}+ӢĈߡ.暧]`pQS +%RrLS$mKi(Gb3 T iЕ>k!HL. B7RrI\r \J`r Pr Pr \r P9r\%r.\9r.\9r.\9r.\9r.\9r.\9B.\9rF}^Þ = '7ԽͿ{zWR6.v;B~4wGiPswurE?*Siha)waЯ*GIH \VU8V:u݉.6i0ҵ8{pTzkߢZ`a`B^QSuFhM1V&õyG=!mQN, "bi(UQj &8 iHXU{i8ӧE9MkrL9ȸܻ-*T꺛CIN[U%'2;SէU8t%kѣRT:Hppԓ6x*bXXNwlR:Q,+y:hoGMž35S7LB~SP\rd-1摬!N8P5h:EcCn@n\P1b@BV)3kfJ$*%Rmwvb\Vbl4RNA5pa3:|Gb]bGί򓾖S[.4c̗[q Cd<nPt=E< Xw _U? wҒ<Oۀu:TozLP&FaQGk2kIJ@-#9߻0$\U* J1 lt0$ch<G9@6R)d1H$jQvct侟)O&V;@1r K .>Ն? uqm)Z0NlRΕހ6\ڴsOQ J "W(\%rW(\%r.\9r.\9r(\%B.\9r.@rF]= wP|x|x^ޥ&(m!Yf6z_)H JiЬb8j\vDt$ZSG#`8b*c'{"Toa?b+.\:ai0wo:<#dL,V[ SerTchHATx%QWu&c(~rEC(.5¥Fk$E炵QHJ#4NRbDLpZ֡B"j[M.$9<wqS(JLn aQuW;HD"[Wu0}*(Ѥv;Bm@05 oPPg< Cdv_ԯ)'nr vj GSP6w$iO^%$fg# (fw|F& 0>=a]7APn`95U،+燰mR|I+XHvH`@5ti.s=rM/8fG֮4$IyQr"Na|֙; _kXL)PhT;Pԁ .n=K6~}I,]vY[(b>Ҋ8rw8ϻJ#c\FbQ2!Fϥ+g+ ip^A AyՎh򻷱*}zcN(DQ>+rh{̃Sqt@E\c :Hb0̯E%piR΋0c0&nK\ZQE zE$zQi狾 qwp( 7,Zn*fIkԷPp=:%T=dTe~e_}"Xv'ʌ`tgEARz( K*P@%\^g!r0?5sOڑO qt<ώbȍj%\yN#SaK\Ҭڔͧ@0bIkFj|39~ [b6p !< (aZU; }vi2 f;l1FГYaNea~[BxH뒊~S-v]ʏh%@f,o㗓2tqJeŜ$H!*1ǎVPK[Jrk6'#Ԯ18sF`JL H4PEljmuuO}ԛ074E084zS6OB>iJX|i )/G~smQÈԮu['Ԯ8/&@,y-c, z.oTHziAF#XkU QsNMàʱm*iog+:F0MA`8fṜ: J,m|8h p6-ᙌ°gUT&4,曼M햒ܯkizzZ(`ѦkЖn7vN'pKcΧr$oj/ӽwBa,Rr#y;B GIhƣ<LaKyfXUK kP.qk-3$+l+T;)mg..A~M$S}#71T/ârciPĕM .POQ{!S]O%l1A t08zA0+:MWҗ/X0q8R!H`{ܒVw49)q3~%'LN@`MƑ. lL̼+T"?tF=>ǭ -A1=jR/ϕ ~ Hq E*Cb;ǀW0>H',L'r S:?*6_$2I-yXFk$:c%;~˕ðw̑8i\(bMV.Jj;X4qinsvHn߳oΑƴXTrт.|iiyXPkIckJ֤e-'`ƅCٍ7kAH E`vuKێ򇔘&o ⷼ>E!ҡEŶ #4<A+7Vbhcf.֎Ak,`{6'h)Bpy4҆pЇRh38k7-WLibbyj;x[j^2e3nZ}Fl*h`#8@j8t&ā?-aCg88QŮcAuqk\a4D*b_N aeV8 .$+d9(# oY҅`yZاj"#.! U!pcm9L<1`RYآ@PrMqe*/yV\`"}(E}ґ4Tb8-בG|9*v-QK0`2S'bhU]5=I5:n% : "/4$b>G='r(5^':)VU\R$SS=?aPRikZ4345@^`fmڵ= i%S05 j8V9^*qU 2oR='q>ԩ8H@$wYrҺ6`[( s*Sust|=!%FJNċH(y^] TqX| |hV] )>Xߪ þU ثsM7_qB|M'=Rt#팼_Bmxk%}rczƅ| 9qa3fZx'93 )$$aw qR1X73 o ¸~ {<J14sz;*_Ds %@-`mXbNV-F~)w213f6( q'N%I}@,ըa P"S Ei!z% t9L괫n`F&%khD5V6$꾝ȖiGʘ0]8SZuEj(htG4[N)1ɹa0R5"@FWHwŸ#cqJNXMAUc`FG.Ũ\N"aÈvQS ÁO,g߲:nn7jH4p$m?{I^pm*gnySDOu0`4F2,6)ӉKDzʽLC9Z/IHEТ$YGOR>Rl"rU9nfAo/k)zm\\@ Wa)WuB`HvBTnj*68a/h :ʹ߭RL_TlaD _bjIh$A /ef:P[/Q$­z`c02(!pN415 өnqJ&$2,^5iʙAhStZz6c薉^$zU؟Pى:wDfB}'52xuҳpڧ1gҩP -=:=o#OQO)&<{kЭyjBkiQHcrSRBTznPgt-6Z kqfB)3;ՃZx*1] i0WTfe]j_SE+39GZ4*Z&G{ t-jXmJm[킹{ֳ`(":s`J9'qMj8[ʌ Wx+Sitm39$("Pl7Kl(tmdDmQaEF(:6\o Vl1-Ű-tnddRIV|re$FTfk͕E0A GJe[#bg5_s}>2جPCKS:I."[Qzff8bfǼDyO38 f:݊ƌ$_dq? dV l6U\cOXsnULF%H-HRͨasg6]5F ƭlFE\yUzL=3D@P600mPL*jUrr"QM:f6M.p9ԛbfuCM"> si̱ƕut5S*rCFc+8KH#egjWcX$hLh0BWרs,7TUDN;U WPVX\P/;˨Z\u:Tݙ t; tR'=Zge+sʰA},]zn E3+F4jE+ ~"#7(tuw>F1=%MATJATJ4JjVgWU oJCUO+ߜV|)TM*!sҗdeUGmgiU3V%)9J1Nr}zoѤ^y ?)N^۝Vjvl[#O}Z6*o+\O䮫TJO!] ,QS(3=kZzzFUZ,oz.ᜈ:q$Co'#QXc.?SoR$PG4x[{ B~TCl uo|&>i/h>ZaԪm;]ئb5ol(vlٓc[]S9k6SpgK\FeƟ:HV/YoTY?V]oP78>ڡ+JrFzf|"qE(TqҦ|zRU-HM"#0~zN4{;QnzOnm^"w`LҤyXT;~0[cBQ7X,_PAzEiZOV{NSW璫lz5Tzܬi}iSP@BzCzoh,n WS@KH11h=.~H"QSO ;*SӨG\*ҤpMpo*!}jqWmh $Puҹ++CϫOg?iL5M5̼GQTW峛\9=NeLO fn-ހk}niZ~>zs4~QF-fqJ}jXuzT?DJI_Z~ +2=kDCGBX#z6]BuM #*)|G4z`/W+B&HZ h0*vrj=6hkA߲Vq͛kx]^m@[WcO-p׎tn3q)8}֦nʥrMT݂VWmoXWdD\GR+F˦j K]R=*+Jڡ\7~Sz$<ER=Wbv;8Z=MW uOVPBGWYh5P$,Ym֌B梕=ƟQSܩ5=ɟ%EC45ߐO䮩L+{?|b~DZrTBꑞ(=wBzzEk `#VU" ~kO՜kTf75JjA~]ϥ>$F\6[l\f<@~ ouB=ΗHbj ܟg^9@zڧpIiS!cЫS|Vhԏj{>F.~'I%[QKZ'ց oGTFǶix,泻+FAl<#P5MS%Jyu0E1ճ|=+w7^Xzb<)+2~9Yzv[oTy]x\p_<#@nRz;}KQ>r@߉=H RgS= *sjXnF֭b=o>ݥB" ;z*女(p-먊/c&ЙlVqxzT62<,&ufmeKn.P`JiSd+rrgR:?ԹԘ ">JjJBxA_R9Z>(U ~HOsVqw%F8n QTuxx8-B)8uOgؒ pGϏ9ZC8qpq]:Tأ@l[/@dKuJA'R*\W*#HFGZ?e*)kPqaf0*-} i6ihl v6B4vq4imA*Жno3t ү]>Ѫ&ꌅlKR6qWqu*R=h 6GJj{?}*\4+O+еyQԳz#-!dr>J^O\pg[R=ŧx[NCЬ>%_tޅuBɾAqDz xuj㘷R=ҵmN|riiwEA*̞NU'okr<9CKhSkvd?79wK@C]TwS?ޥ#S=SBڨhU4Zܷ&$p@ =-ubs(Ѩq jnC9ӭ+V)joҡ3d٠-+StՀH!F!cczVUo3VScv}Z8!U ZƟGI-,|nJZ󑡤bc_c3o: 0^4X:oi%-0'f`o$ܠ$]8tSVe`YŴAsGU0si=KJ9\c,xRt֦*IoL9:u0/a DsYE.,;I[`qӜa9Cp,cxx-ܑe7<{-qQ ntԤc9B) 6z- pSBA2Wh>~~~dPUm @4ܗ8u8".$ř߽5FMhRj'p[6$6z12<8Ĉ44IUسMdoxnU_I't.ӔBM֪:@ف6(k&*`3RKMAAlIt2Pgf i{Fm<,q3ڥ6@kX̙M.6"oP0kΚPxT؋pEaUi±]D_Wi|.gt :` tXkYRqXhدC]\kܮ= a6!A.'YEc״fn`dASxI9`ESqrR$VJtNbXxܬpt2A92SP86K*ӯxU趨:QUf; n>tuWm7 4,k88lS$¶#]08mSԅ !íz v׫F~SK@̪rl+͋ˬޮZ08rBmGRBc)0a4SALZ86&)IaqѤrpϭcdo X9l9Pv44N-mcm?3zMfҔ!a7,t[v&&P5sIWa/rMB(upEm[.~3D!˨򌣋 nZ9 6{lO_g7Ej>sEԧ({bbwP6 /Yg~!>RIP4.Hَ'H %R3$FWna:;bX9W52߮R RJx5yikb|SmJ Jm{)ՉZ>Z7°kߴU**,DNOPs+: s:TPP)T\U*"z'݅kf'3 jTd(U"^F.RN=DFY"tL hY Y $NL,HjDq8څ6cwq%GѴ4=:oL>Dc 7 !B ɰ6b'(X(Nԩ[YIW] ^c8jj0x' جEJdhkM pi7@!muM|_c9ZYSd*) Ӫ-I'0&s7u#b' jvV.znQZƸ;4 % O>ܐ!w@$ƚ+rZ3˜o1+b?cCZ MKj+=^&3*>eEikq~ѱت~0>)-SNm(Xpٓ6=9OXAceVrY@Jc"OzͲa;g09a(1d "%b,R ZϫV9)4PO|GyC+I7ץNTUXU/s7ezJXr#6;K^Y;M:B"X&  x/Ieԩ]H^KU75,Nn/PPtkD8|LTHD1lfQyp\zRy#_RJNcj< i"LUDfx#Q`kpN0|G+s"X jx7iOqK$E"xֲ)8 ubYXT%/vslsoY  pbjPRAhA߻m_ 5u9W6d姮oF TbLZ^,vvAx+>On a1AH Aʵ1N4{[dBYP)ac9bgSɘ*7!%٘u6-;p8uMzKѤٵ]SMY3P14K*s3/h]3MÁZ=ia'POXa)i%2tCTfE>WLhXmʗx^Xa 䙙.!F56ԯ] tsԢ1khž"Դ%mg$ mVTtb %N$K$]fӽ[  63@jL=jX؂dQs"f^D-CjgLC"HIc/kÛRei!Ejtl3vdEiLraf44N`-U)eƆlWv=`ﲚeP 9<BڃY\_R& RJUqXvhi7n.5Op-OA/7ֹFVkT2- (ST(\yb~i/R: / MKJ/a#$?#4yG GH֋X(pfJZ\z+,BmOFqQ|Zp{A/h M4 */O?AtrɎsa;"WJǕ YeҲ5@Xv BU tހ-*eb*ErWJ+rZw. (i\sx25[ %tvGu҇5@޻lktCkZ%[Mgxi!&7ʘF.lE-kCw) !P*y[h ZRl!c ~-sIy.RN vC6rxC5ؗT ]p!cW) 7S6]_J6fKHT8rA E ȰR6m!xZ 6e6bBǵtg3j1Y`Fb G4g B(VEJR"m'ƵĹmqt7S* "gzR~`PLyGyˌx [cSO&8~,Q0*WFF8Eo+a`vO£H8-޲@tE)#"J&VP ̅ uCmq Hqfr@2w_&sF|V%ԪLoZ9إfWrse |QFgBˏΪf5: 5TnUX_Ip@+Z&ܕNQJr,ef q7&Ry`X=$P F Pnc Efի~%#퍞|*@Pި縰U ˼ djC"@!+@vKW&tVkZ^E]ZZA3h>XQ7]I 벚x+b\fKtR)9CnHt SAf5ft MV3.w5a[+59y16*dTgILXG l+3$RMF I-bI.{!_؈Qٌ,*ou h1pЯE 3!kڲ,ŴΚv+-;Vu`SqDZ(: &,ae*Eu@ y3DO4"5P[QיPxhikz@PfaEIn[_UR~+qRVƐɎMƭp4fsB紸Ǝ-&Z@<VOW< -$ ؽT9Ysbf ixZ ̎%]ž\hK  I ʵjGL=aPLe0DHK XpZfU Xu"@{b6 R&5^s2D%~YnV~\֝_a'+^@Uu6rgdp0* k I%g˕F[ ؊ʉW:Ԍ sI=aTpRڴDIݗcAM<o#XP90LZjp,vR57]F A )Rfܓ~VzenߺT5HBU&)4w*efX *YQA!MDcxYU]lY\yGU607oPٴ#9E9;΀qю}&1Ź=[Hx 4I?:{3@tŮk8H8gKu.Hе߹%kZGűVn"'Ǥ'&bmejg!cڳvAPq#+Jd)Oi9k y4۩WL7Jk>5U庻ֹYpB=0fj.G(mj;. pܧ57jK:3L=ڬ iN\hym q3]NSfs%k:ILQn!:Q)63ڰP q(hXF !$Mi7pB!t'nHԖifnGJPO_f@Cu[aIY VvhI@ΡgU[D%jT1{)@im} ;0l`8iLleLlot:U hk#k!aB90ҎV7 TEaİl9>ⶣFI*M˨& (ßB+'4SNPK9NLC lU<2$ֆĺk89VYi˒a) 54> QKj<~rsGvEv*.'Ѓ]{MxV\׵e[.x+\%d+ &H AX,[ys* S~-~T~W1͵} )`;6A`xٺ27Ζ>S)%= 0d U"mFo⻔y6=J PE&S3Yުsn<rUi0aDRf։+y+*M+#zA5J!@-XTfnTvu!Ps֦"\bZ6L\HA>xb!~Q E ݘ :Ph$t(-"5zAЀ8PqI 1U&or εzur :8a -+joc pq땣 TBL8wMy{W͟7xtv]L{T7\=[ӧuCi:e%4ۘTo Xc*yse$qİn#UEګ@VGư: *IZ&UvSz \26uӹZFMiIA^nU'l9twT.vFs @6wəL%k242fP $;8sN78蒼ғKgE6XX~FD(~w i2T ux= ^0y a! &hmR.c+4D4܇+*Z, 243-kWTc UpM*6V Y}Mss@(\ck?/Vch Z,?{Qh0_!4( b;=h.c!XH#ʀHIfP4pc5L  wjiv#&ţ zGR8;: 9RYMR?)8ԃɜ((kdqw@ۋՈ10Cj YP-B8899`˺T%Jy9>O 2X+K7 %'ҖGLxR`+C ]+9S* 7CdWȺ.\1nAvVDOEa9@u-_9CD#wj)^T0!@~P0ͱGZa @"ЪT2Z ÜC @ `B MmL*1e#tR %4&nqSN2XiCxZHKIeնO<\th &MQt XB$ a$cUP4ճR[I0^ Xy#T )0'o`f#[. Y:kGAhNbW CP8FV f:LgCeţW- ƽWZӠx@A ix՛c *DJq-!^M;┃U ӡI 4\v٦dpF6z溤1nc\fPnVjRPQGס \*VZ5ZҘ~H! RyHiJ +4hYcl"PBGGz&8(!2f.o*I {yg0?#IyMDLtZE'Nf+T'LUg \K. 2)I-͘H-`#L'K,*`*7KebIgT[B :*IiR(&p6(v&SO1$@XrD;){80Ep89LʦAM rp-DX *֠[UvJVuV")S@SLL .XUI"/ SMe4;TI1u`]#Rt⦈T|$ָXhּ$5J(ɡhZC_y;I;/ezr=Bc&ONcJb ) l ;M)&AcQ%CCvǩ{;GcR39;  6{Z@:̕fQsFBF=eZ66;@FMs`x]RnI;E43h(蓲3xU*zK#CQ2//H3aPcN&,3@Ј*j:VCr޺;0+ĴrRC@|^*w-@HVUѢ n\9hjl򵧃Q=*0CLY<pV.@ڼ)+d;U,# G$TO;O*L%TYLΚyL8 ,c"=)9Ǔ X[@.рyYkie+PL([@tiTB79EдWhM IC^RTreUq`f24^=>2d~VאnJ \CPټ=pKf'0]dv,QJqVuwZ1J:HgCԃKeY.eKeTY)l:GBr 0jztCMLAsz:U .p#}A jUh-~`$7v&c$GpT{sqUq&G/.#&1HUrx@-d0I1>VTw83mfTO#dr`4멛#6@!r0GkIq+AS+HhYVfb >h`wH|#sWsT'CKCKoQPցŒ]B1lM7(ulBuB l=Af׳-;P4!$ZM s*)$Wp6áTyި zU+e:V#nUQy@4sk?:,?$36b9|&΋q81kpIܙd/jkbF3qk$8`GJX8|+ZRnaxs.Ѡ_(E0.I -\'.-c#Y>FvpEKSu,(|V ,wYaMXybf5`dc܇A IMT&3C0 bt8eЫLY%ӦGRu*D ;uZS}&;3|ċ27Iy60cb ?3C^GZ!bb!mLƃ٢4 l[aY m%UnVԋC<=1ΕB4%i & H\tCXVDߌAZ'+pT"r4zM5i\;ukS-i!Z)R6xBR"sRF#rli"IpLMlې.n I17Jd7A܈44sVSڣz> w˴#oPJBapծh" iB-SЉXUOR;zф3ث1G*Y5C-0icw V"#C๙oG:mEh*IRa۔N&MΡ X_Ua֦D7yN@Sap a^Pfw[4':7%-4XXkM F /sж݊2 G!Ut'xs͒xDzP ;ƺ[ q4v ZGb;uiszƠsNTAT# C Ts,d5&uPNIx 횒H)3T9OԮ+ns@-Ob).|vK*g.1}ټwv VspL/%N!;zҠQpST% {#T;pݣo&+HTj*<޼5e[YXf;0SIn3&I y3c=`^$EIYSNLi:zԸ kp$7 -Y2d*h)2ɆUn2I'|d2-Tw3UsFfYTh)$Sqtՠ0DAUnn(X^L\./T* Ýn N@ @;Mel:,-:i ^reX^߽'e4A.I҉!MNɃ`mVu|YL<8ŵIWZIϔ 'ƉHB>ڒeøv2n r8`48PF1ŰTe\G&C2H19aRsFsɵC\gPH5JAԙ&ӭs֙ih*YSOP3nV5?T5'I[rx  TmQqڪڠ*=Hn4P]xUg)VS}KCJ8R'`w Qg\d!Z*Wk*<$NӬjC3XTV \JIh  !:ڄae;LoUhms:/fz*n2= Mtpq[ғU+QLӺfC~XP"w*8iֲ4\ ˲Bΐ#}"FEAߤ[ &f4w-q@J_ILCd,B Z$aȉV.٦ H5!2h}6_"ظ _ Jdp%f26!TMN5o-9j8;`(s6wX /tjY]!K$$΃ТeCС 5N¨Z]L@0\;V1O(k׊ϓ`w"XlQYJmGaBޮEY)|@F]'ہUujd9zd򍷾Mhsfl|QvY\)n?han kGxNIU߰R? JL+<ެ08/)59ou^Rܥn\Ou) NDv pT~sspǑ%ӗAYQҬNtNZH.c Dn% ezn M# vM#zZe7T&"+q UxޤHtMYTa27BQnA{ ѕ ܥ9=WPuF4ypڹE92wIz^9`09.uX='vXJ ?0NH 4rLZ$M~LqWbĞTKqp֧b8D31Uh=$ۂ#1iiP0Ӽ[T3f7 2 Ž (&tPJB)Imsբdk#YܦVT:$n IidN jZJMJ QU|= *ƙ0l'Hik@/ vǥEJu2͓LQL6$+VTòFYeA!͓kQE=MŴQe8Vys52O|.-*ٴxv&:47hAH&T֠'-If,GSOΓ.G65 4Ax>*UveNR5YwbTxnk\NЪׇB IiL $Q.'$QꙎw"5 &N]Q2BKڄĒ;**`w MCjUAw'6ӄkAG |?ԡ0i88\]͞ z3LT> #QZ58Y9pΡNd7(fUFVn׶a#{dOZʀ#gs6t腅|}7AtDZ[~:L#,LH4̜,lMBc$ ;! W 4ۉUNGE` 4f a-Y*¥=3,]vmּ2诚sMR`mkuY9Zᮤ&R̰h;t1m{GJ`$7`ycCx'Up;\F½R|7f)EL3r;+Kr&EYM6C\rZ8R ۦJr'Gö !.v`ZmK]( EAz5EÇBѣZA*y+MfBtnI6Sch 1ZR!plQY8Q-ޢ-*Z CYimGf9eRjox`4Jn\@uI+Gj5p.s cPX2d^)SzʩN\J@ĬI{CB0sjjw kBf͸-Lp##=L4*iP[BȶX1LV3W.nc% 2)L+*@EKD0B)ٝ N5NZYEHlhgnV ӹRkQZ쌂ӹ 0dr Ct-aMeQ+L o[5ܶ3il@"ZvV5D8'nZJb DZ];^5FzQ.KPCqpT" ELV`1'bTs2XaVp/"MS$I#P WN]MϥRvŢGL[^dtgL 4PWp0#+>pZ=I 6x+gÎACaOx0}(;dzPm7H77NܖY8U#)T%L$HRswJ ˜E߽)c8`,8"i*丘Q|WHUvĒ žp:U"l88ր*Tl]:u*ԤvL5tNxJKtn ƷV p(Muj-74iڴs);k@_ЮczF)CA(I^6=Aql,Ф2 *]^ܧҤ0C&k Ѳ?8q {tU h"`ܬ٭.p:56 ƥqy !W!Λh'f9[8mtnA6K 7oR@λ͂d%e B !Ѿ5o|Qu&f m*PP 85{`!A8ؔ!q,'1;M޶=U"جʡikdܨ n0*9ӗ9$VDD U!nc=2H2{08>P.a.DnWF *^$͊(`9=i'"¬)r.剤h5A ,mTf%hM&ە^|jri4;^jIE,a!ސܤjbf:'XdI( 1{>ޅ 5Y0P-Ahcs0Fɺ|Q;V[cQ?-LOS 1fGj'cHzW9#⺑9 zP+xgJ[]e].w,&n74nogV0"5˛scT%V=i+AlP YQCDi%> K'xP#Cܦ 'sniE͑ɟZ;Ge;vVe&)5Lkr*~gDGj3RGn"j nIۘ'rl 7,i "i-D0@038q[-">QX89ZI'hkֵsv~vƫHt=eY{H'V-vo@Cʧ'dS|>ZZ\ط;COk1Z{΁2CT;ZGjf fDEYż]nW.f"TnsS9ZUj5ͩyWyAN1, J17<= 4KЂ*yF[۴B-A !x |/ ͜ޟB7p. lF$2l4UmOzWK#+pU{YVgS^ŢS.:QPD-A kfV4Th-β=(}~HLʓ 7wFQkpH,:p7w$'L:Z6nI[h.9ѽ`ֆoIK Ǿ0Nr Sh2=wix{D$٤Cv,ͳR c> Q͎oC C.`]qb;= 7.t[xCK1ſW2{U0@i1tc 9ҧ-d\ڎN=EW},A#NwYhw8epIy$Uf aM8+5!' ǒoO]c͵1#^ufo#ҁ&fi/{E*`MSitk>C+AlZ%;*68x2"ek6"x{0O} _QqUaO!X+ ߸,w(%pYmrx \0|J҇5~d%&gwX) y+gBl.(̼EHm6Ln5h=ho20F5#Bi5kJu֬Dm6E25 \q'%IitcZh Ti.7:+ܵZzF\Bm2w\iPn'UW-~Ÿvԉ\\wGcB3H"[AW4KZDVsPnH׵2f:Mx-IeR $vHpR.j1a;ۻI;<8_47EtS"le!Py0n` }jHEe'Qf k HzJ۔:Zĉ7ШZ rMɽϥWU{H%]Zf7XUl־4CC~Rt te]*FC|OS~u! x!ʮ =  CKH@F"G4ܻ; 6Uu:ktVhڝcdxvkZ H:\BS aZᢜ4SpL/f7OHss`TK^=(M '1BKΓdA C$v"7BzOd,_hL[Arj3Ҡk{u o >XyNgnhN(m$\$\MbIRX5a`62noHG@'Գa t7+%( z9ٹ@Q0g!hi$^'p/iBkJP4>#= ELu*+ŋZuu+F= x),=@@ /`f"ZPUL;6`Tv!6-rO΀.aqvz?]ʹXT_#$bˍ# iV";_(S;$ɒs@" IJ#!% pfنO̭Om>ǯjv zlIM:}qf,f78H-e:BufmqnN: Zx͎XE)eL!q-1mAqCOm7b/2TR J5p4āJϒmJ:fiS l;k>h9YyEӣNST\<0Mݘ6^i|k%DCo3!Z#N  q4\`[^0u42mSnmz >0{<4Ã#TG&d:&*kUשUpJj@Nix@ި]ʶoTf[6 Z= Cđ"DnrM`7i" 聲ay Tc6m`jNrC+k ]/8ڗIdj֏w4 hW|ɘܰqԃ\m)hqKW5hN1"*eғtTZzUMΥeg4ZWO0mI:p࡫ LKC4fn ߇5@jhe d@ q,*EIKmn!Q{i˙Vzn1ps;r؂p"x=i6 R*ԆCZ; ʴW;+D`Jʎ IK:ٞ5DR#FX6q扆z*9΋t'z^AiD:U.:3,<2wY` p1 h$ *CFPYYvMjWs@ 9\ _MW:>Y6^x+Q!]nW! fGz)h 6. @#].o۟*cOhRH#bNb= 67RqS?1Sk=d 9p6MX^J\O+"B7$5Z7: eUene̢{YKBf&jJYiGh)b[0vd™1Zζ{v 鲱KL_t.h7Ѫ OԱ@c\kdjfnM=JpvA7+l7:ބwg.D ^" F976fY7Gu"1_D7Ld&Rf@._jcFh++_3U/Ji> 1~<4z4{a= JNw`*ԕЀꡧx,8ӏ u7и> [0"X#4h"B?Qք ҥV8o44?W OM!;B֤m/i)sT~h著BXNjkڒzoi"J'ctp\LBzC.BݪRʭYU C AsXaĞ>u4C焦}|Bq;+iT>&#F]&[~ys\w^G>~R)Q$Qfz/toSnZ>}UyClLzCU[Hwh%`ʖ{zxOsqE|U>stream endstream endobj 34 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD50H"   s!1"AQa2qBRђ#3Sbr4CTcs $%&'()*56789:DEFGHIJUVWXYZdefghijtuvwxyz!1AQaq2B "#$%&'()*3456789:CDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?$JL"! D>;$k&` ,yh.kq!i~<Ervް:)}=50\7/GӰ`^ dwsXKLhY5|.izl(Éfxy&Zշ Rq)if .o·/ԥUU&ЍF{Y.F>/K|9=~[!+lN> }blTA].L!OK?Hmm5تw !*E"M "ϊ/-XocЕ D%B R,`BT,`BH,`BB! ,a ,a |QISdz&2nơ^jj)w̔'+Kmp6Na,`BJ,a0P cB0!XNǃT๡`5* >-hqtYyzXZ.PHG" B0!@!c!c B0$JB0+4iy*5#swaإdS^%iwLczB6@>B?KIpN!*DL!c cDV V1Mٲohᨼ᥮x'isA;Jɋ m.vܱD=AL 8==bMǓA3IƓ}U' Rs0\I{܆͟4WioDaj@G%]!4ZC9-;εl7vlvˏ>PZMY<.4( [T&dñ8T\3? D/hS>XVUbD$%&Bò\v7yqyhB0!X%B0$J cX!*0BU")*EJ"czOV3C'oZm!kuƁ>k+'lXVdﭨS=_*{)5+gn\xMBUu9y,-Gfp|+Yrq$}toQjlNlZa G=OxԱu#̼ծcM5_3̘|^=dgmRbq~/YRU(]Vlg)nkCŒs\ZZG0EF"ZzB4P'!*0BU"cX%B0!X"p 2ԮUbƠ\yJJ pKceC; d&BoB53lhzyl1H&[q`fh߂(_-h+օ!;n{۾G̎^eêk8yQ2E}J|Rm, cM};9lH9@$Qp4 ۘRd0,X.?**l<ò͌_>J'n;NcdQrAwNJ.>613/ʍڽ5 |/q!/t.Ӥ4bhC&^Z. UH^WN-v+=_uE;2;vOol| K^OɂH-:}|T  iIGFCaek1 g%k厣bh`BBPJ,`BB @)\>>6 y43Ebls0g(>31?=Wzx:hu΍gv &г+?|B㎳=ai0Fnleq9VHݶ/ ]_ 0,s[PU#ː3 } ËrYry[\2X;uXEsD ʑJR ,`B"aBH,`BJBa"%H*D,c$KHD!X"0.ЉydkT\~ A،: q:I!]Z#K#ɭW^ H=mq{Oo̔uxAzTNJ#Vؑڈlum߬6ۭ jpKzE\sN^9䵄F@nO!,EY!șd oH&֝Γq'nGkO?Ry2U}fE;RqA}hͰ|5dkLY) >9)m!li> ]t4cF͏ 8Hy4ZFS; ")@v (GtNJƊ" J ׏RGp):\\rVٚi\PAu7&A2M9&"Ր{I6B/"9䚉} 0}Ko7,> D F2gvp?E!< 2C*X69 @S%S[(ƍϚ4ZȴE[0m;8f8h>T(YFa&LpP|VaE+=Yo"1^,adBfp\̈́,*Zhp4}4xG7#˸o6ANkI!PW JTX`<boӄP 4#ܷXX2c"T,,Øp-?*tӹ 䄴dX=tOhdr[1JX!*EB0!@KL._[n \M~]ѝRvē;1ѽƘr4mvث#dv ՂJE#w68Rjp v>2r,B9{ZȃGMB.q,Zk'`?ZaȦo,>Q0XKcmh鞦q<}8*cu<&R=JXPJ,amuM)e^b@|JYs8yH^J-3%EB$j׆O kU=cH>pY4R%H!cDX*D JcB0!X¡"0!X@$D¡ 1!*0B0!c=0,|8WΩ)i=˳y-za0yϊ}; XOs?S3]2ccP޷id܇#uܽQ8vU$! O3eX- $m-wFScVtCⴟj>Q̺U 708Dd۹dWFַ*ƛh[Q {"-܍} eNv oݿ<ߜ< $LD5yaGuBSB9 u _$25Qe7!R sVGѾ410=zܮ>zm.K"dS\ŗJm8MX{2:fW|K#h<Ν N,}MncOb̧HBS5T82\]#ܧ))ӛR8^y#͉oU pqLܗO'H:W9?"ФV"L9icwB\):ΕJM"D֭Ԯ&_caR"I#氚w%l?f˞ͨeZfϤu\2JEGqFF~(Ӎ Nf; ! `݋ynf%pqk\CωpQΎPس21{u5RFyn_xVr1֏aA/p|Li\38' ͳ>;5޶Ҫ.WhR dw2AzQezDuzkșTS1'ntQWH kokr=q(1<@;:wdidLЈBd{co7Wu5ؑ a{ωj[g!9ˑm-gZh- <[*D0M,2<4Z ,4.n8* Qe¸D-|z\$ckѱU'H"y9{rsJ8ZjRʔ@u[^:P!*0Jc R!c.Jq ":)\Z>UzjQRMhie'Ssc,?a`F:왧M0Nc1Ŏ&P0u[Ct=a[Mo~nik7oԕ/lѐ'ta8ahp`dSgwv—XcFH0cqcZGSWMøw##lD7T9ub$}PWUei(ng$v 릪jSKMgB4KB)!ZDəޑUnqo lwlvT{ d!B0!X%B0!@!0%H%@!%@!c"1ɡ*0J%!*0h,,&!A]2L|i'#HJV:&=;vJU8(DgSZ,a-wڍ)|k`=nI]Mu?[;씖\ "qk\ X,$9ǤuEVl.{ 5i'z't].Dx+ c8hcC6Υ#".ǨYQmĞeY%!I >6\@]eSHAMrp#Ul8}]dqit8H gjƌ膚hePZds+AA!ՠDd |kY<]e B6E0^>@Jj29.MKjtZ@9;{mm#i&#̸v#y!T?7LG=|㏬#C}(Ui1 1@0r%V=j/ᬃ;"Cn}ͯAv63f$- !.J]>)cr5<6ؒ%Wҥ榄mߴ1 G2F z v}%3/t/qv]WA;amt_j۩ 7u+_Ot VO$K VHxS\XW:}CGz;S8̉ObAhU߱VK(jW3(N{8SH#l@B"TR PBB! ,c>fV#cρ_{ʎ3~3zrYxL R]UM\z>'Kd q:L?AwF"yq?'%j~Dt2oʹ**x*yXL9r#͎#\֛F(Zn ֺ$IVeZ*ABڄ,`BBT,`H D%BJB UB0PB0#t!ʡ*)1RZG*E'O;'HoHy|lg:V}*;oCFݧĥ E0cdhwQr;C^4]c{61nq-iߟȣ,qPwW91I?^c|Xi}Fo4V8׵|Z$04>'7[aOÑбa-yqG55k70Dl]WA˯&C%,1WR6$fI]P>* z8cp$_:SuNHJWGIFscDɺu6opILODHð$f9Y47ali/\{<:^OFԦ2R\]˚@C{6]tc|,u:M*xֲT!9}mXb|OZ4ntn{|z(1S@=n͊T,x|} olltR|.XX/OisS8sXfSΈNw׎8*-ކƆVt;ښ_v% t}QCr6*ՒReuo)&lNcJ]DK&a ŨRK 2ZQ- {x,*5L67<΄~U{Z&qC<(XlVcw[6[zHdm u>Ck{ws)cLhMCDZPs}5[Z6h ϊ~ J%'Ȫ\蚪UJ.!Ç#xLzf1==Ĵ]S|_,G8Թruҕ.2AK@MۂXkdG0: W{ U+9r}?:5VG,/cإşb;*}K 7ci2eB"scl0\tBU/%8ͤڴff;F$@cqޯ3.Ŭn# 'wtG&d!k;{<ՊÓ] 1N}>'Ag7ETF$8uH=Uc;Lb;V2"CO*C04<}v sM_p2G2#pjTzñ օ;.,x+ hNMy zU\l9-s2Xۭ_bYtN H'^Ew t Vםse6FtcP[+.c~T ĴUMʜq.KݤhʝzG; sXETY~8^EWQU)1ZNa3܇#s2A :^k~NT~qٕ tlU'Y BG 9[Hk@[AJ*  PBBT"! JJ,`Nc1Ů/tGi KSd kܞn x,$يu[Z'q.d1tZye9v-YR' ~d͉aA܂B:EtR;4[NxB@!cB0!@!%%B0!D!c B1ˡ-#`ұ]!CƂn JGK XOd 1۴deIc#đ9 |!wJ]/8#"Of[1:i%pȂ9.6ӰnidÈʁ͌<Ѹy i^ր SƝA/RS7oXxFJ)fP6 ի{QkH83ǎ9hڇysK6mrښl5ݹ|i#\֒ 5fwG,[Gu܈:Q!ġIP60 z6 E;KߝS+ .4`p M׈!Bdz02B. H5K1HWG2'2rSݳ6ŝF9E<,_-`,E+P$B!By]*Ic43Mqca52Y!U!Q֘ $QWF뛏!r.7+#%Vy ɤT/s;gdc, ='!q2 lŅ)y^_Vg~5U^+'$+pܳ#7oNJ |8LLfdo+f$kQs]>uk`I2V#bcƹ X - }~!Ģ2c5EKӖ{w)—pKGh 2@őikb;h}A/9B~aX80N4Uvn? y0BpGxyݼnR缀!B! ,`BB&! ,`BB%H P$J0))c jdqAt9]9d#ܓҵF{ia\9HL'` sl)uwYlO ґۆtͅ7N\u1C:<)N/|&9zaๆ=ҬhjVg$du,2<>TI&$sXvkEpdӑ.tQ/ܗujJ<,Ŋ]{.6lR2ߧfFy۞~ˡ|934oe&zDN^,EC^bO{Xި=I#Bm}ZwȒyx{.'"%|Y}r52úI~gƽ?W*~-"qrWaSt} !݂Bʆi5 rS stŮ2ȅ=x'{>쑤$<b3^3; #⽩](/s%a-5v %ʝH;0VY)oU :DG>IM09 Eܥ2X{B`& <ơu2dr7c|Fc2|2WA{[-7Q3ÈWuQ'6GqmaE<5V,]^W"CoA抱'l( 'K ^PIթq v۲$ӘC-u= 19lZx,$*Xi7 vMLd.n }K&oځR%^G dPPl\*8dsgkK Q2'l0B6pgTl FT=8Gs%drc88w{aOZr͞7}mq/Sh=鎱$-p<ElB5* oěL+AÃn`s֝ca\qg ɏ)ӂ^Ki e]9jW | nOJc j)\1b-yw< 2OsXW֮prgS];iqJ>xgQm*ZnDN?11C!kp@!ߠ|Dm)]# juo 3M r<-'&/ tMR~!/nL˛ݦNUQ̈A"![.G+FJ0KU*L!܆>raꁧch:b:hOn+RՃ}@!={A]}Z{C;>R߬Go+NR= v+ĶYL3$J܆6F(58Uj+8 ̏7.VZI .\}(`^|h)Tɝ+͟*|7f+ݠc}ep3Ix>K 'WmA̖X"HiZ+[.yz!"v)@v\֯+ܒ\ztGGMύ oH i ,B>&N1t~$m&!t r%l00#5ܔ#|OtRױŮi4B!a 3*1ZKp s^$i%ĸ$]q&k.HD-M!ӵynw"gfa ηڣ*4v )fB!!"`BB! ,`BJBT,`H"?͔䉀4NHo{Zd1Eu#CG`B״fvvwõ=Ʒ$ڒ+J.*ԣb9ˍ o6M+%?S߽"UM Y~ɲf)/9[}oj퉅S-8jەD[gq$kq*pV8 0nk=A grh*ܜ`5r"9d\e?AȍniԐϏ wsj Ç@gU5ڸdiZknZA@ Iw=˚#yo{Tx 1-Pr8~l ը|VxS 8L[fY5_*Q P&KC#AʔӰ̦>otnl~Mߚ8hǒ7P E˒wWvZFb3577!Ji2YO$F~5Rgb5˓̌;UGȍSčSNߋW,1<MvS*GL%{_+ Gc;l;>vi+fLE{ ~ͧo޹ 9V=gU!:~o7 O'HսO>~VddtMȕɍ{]d<[GB)Lނc.fDόoF*3qC^*GVI'ҧ.gc-;b|"`^:ԙ+!Vy2;"k'7WTx+h_ùuf^+r#h ~u +,8?QKmwR )W\hx wQ캉,X;wW3&M4CwGV4q$g,lϟ$.lf!xH[%•ӵI˹fcwprp%oUn_ ]84GNth5ߛ]ʺ^lyɈH67]w |0IKgdb8{sVRQa3>‚F#Hd82xkv6#73/Hےn {MA<6M >iٝ!)$2"k>$E*V4Kpqbts7wUyG50NjdAj`y>dYyNe+s~ Y=x1e%uQɖHKh,R^< i4zQ;a5氝,lo01ag-xIôzs*d %tTw:űC+&5V^Xak.1ݴMZԤ$mdZ|!C#[E)uOʱ8=3c!.Ձ)Ҵ:0 p<<жUZS0?NҒ#C}ӽ&7N ư Mh_*6+˘wI)Un.{ t-v߱NᑽG }Eq9GU}BɼP8F>dUU3!A.foYƻι6AW80vF k >!J`,p-6_7 áDt663i'umP߁/UUWcN™ġdm{K_#x&@ɜF{ZA$amr{~V\taB-1I8#d̅:FŴs(X\i5oϘbMZiśgl#uZ伆 Q۟pߑ_>0ţWZuv[>LsX9$ p2<I =4@zv&M)q]t leCD[5UEKs$H t@oخ剚"uikMohMtCNJ#& qz9×@@rznqlF;W-r*|4n6;KKSDf_gaE'08KiJǙg[om6DEǮMJ[+CkKděm[waO ~b[jqʺUKQ(8SvlgLGq;ܫ"p4:STy8إ$=+妷[m4r`Lq57Se,xZFbxsX6- #6vTV %j^0.Cpǻ%kŕ5- yn3isw 7Pa>6( {wsH<,@T' Je_\;4Bby3/ *ˑFԪSqXS]fo o.ia糱BE1AB&!  `BB! ,`B R,cDII2Rr)c}Den gy:Ra-UleǩI;VM)9CZKX6h$ >[#ilFw 2 ^zGnUqqYCUYļ81qkd\;Cfp׸$)3*,'Ts  س[ Fǘ`xŦ1,CKoʄ\ < ՠkUrJl@e=vLk`z0V^mݛc 1&L1פ`-mBݍ5x ${To|<9ܭqI6ѩ'DqI;]lby{qM#cvq\F@vڨ1q"lDmy{an;(P"8Bʯ)U![t6-|4imvn~16u 8ysےW+ Z_2X^:6Tku׏);;wEqjEyPÎ<ƃ{7=׍Ee6q9+ qu5vE63 g}[/})lqofPA%Jb¦2Ε l{rc Qiue5je#9ҽx6"jiXKVbxt8SjY!|.k^7.V7''l`a$-j<͂+:ػ7+QMTѻ+0jQ14ٰA6MRIXѐ׷ 8Aju|8.nfZ\ ?m=B,"m5yHDnr*V>#eƉńW\8b&u>,3ݥhB)t,ljk镕V7Λ!>g5nU\{MKEi$ZNh6$l7EzHIW58Xֿa$'ȤAȑ&$ EjnJ$c.HP#29>9N;#('屍v[ٶɓ[g^LNl$\⣎%WIXכ iV5qFUK+.GV5ŭ,yp4,_%=5F5pYYŲV r0S_" \m!<+ "9Xc2:bO_G=Ɨk \77c\[&eW8YGƑM4fON:z2LΫ5WaXpQGb1C($VnѕqaLTZyqjƄr/4O+8tV9iEBcdqH sI|O=R (2k\w:Gd1Y,sry.Ghjr~pHΡO~\pSHSSNETIlivs{%sj*qz xˇX9m+,x2;]wBUQvp;$\y lI#4idbׂV3ꕶ)m'S]Q)¼mu:GwNjs$[Z8?%s~Tlr>/L1dl{.{2v_( pk:M {Hv8Z%l5os^ZAL4ǚd!s ױteD: ;”li6hX&0QI+,yWcwL !hX.@yű-"O#shjGK+pn&ZseP25r2ΣpIȅwKm#66E_Tni9ED]x/$EݝLFilkONtt Jcs_@Xn"ʦ~#].6Ll|Rִ]*)z*:Yh 6ceEMbW)W~帞17!փ즊HXoɅ̞'snڀ;zUUtSaJ,`B R,`B* Ӣ!%'I0SP1+D_$ jkTgЧGIĆ :e҆"ڹzräԺ"aP|vN<49/  kkX$|E-TۗYki"̢Cz0f]o-i[y]KCvp Ƈ[1-{sU88 n)V2\l:7^XhٺxZ,bc緡=i5vxZOrZ >eSC腔v,-;aհ|tLԥR S3>ဃoZ83k]DCAw :r[?НfBD~%)XK(jӽ,[}hyAfCq<;JX o:H()+u8@:+lGc@;8tݮ)PtlcJ|u(l U5s4\7 qe2L\m!T9RYq $\*,2j5Bc,%Iɫ+"HlXp->]̘ ( :494OL~DXw"|I\5UȎ~\3o2jx7FNn}.oV!9sX{E*Ireiɵ5  .u$ w]TyJ@vX:a'Nn7AvBs:)FDJ%.>F \$b7)vO9IDTgM,9/'&g7gvkvp nCGDCtu "\E$2]dyn%ge;G=\̄<ۚL6c?/< Oʔ6ŤP'gTW]"I{H؄ɓ=lK+"xx%UkM8^D1+ݘC]t.q,I(@R1hp14Sb4ɲ@29 !63Ä*3t޾5s61;jȧ#'tx6ǑtL[~>CW [/KkE8uK{J3$a|$dhz09BKo2;>{nGdpi$k{^jʞ^yzi#@sbI:E4,і;>7H#'K^|ۮLf)q6^$aFrM"vv7VӬoݿgzlG&NbyZxɕDoW@ÀeMnn`慚CbQB `S(#n}#d:X(2G(ޅnpsX8)nAQSfKJE*F]$ɏ/ aGsۺt$ѡv-$ ͍!Qc:#XuP)Ӏiu+|D8kjn<[,l{[Ijma9Å\fpYg$eX<)o䉲4h^-tNkm>)4RtZTyHɉSc> tsꑆMWMceBMPɛb+W" *il4A~dXz skjc!~}ǚ=D|f^v`fGb9שvښxv\7ȏ#+GJ洑T!sxN `3h X9Hy tqdK# tnpmRtt`5UC.w=9cktzU~4ϤTm#(k/\orqF3#CcIrS|9 ailNSlթçcVʌ{8Al\q+Λ7Yy+bSMiVWqQf2blBB! Ԧ!4Gbp HRs99?.:DQU qHc )E"DX+saw@T~tmQ-= tN{Eu\6F9s/#c6WT5 &Ϋ>dLڞܙ[k0i${~!8; P->EXBLn4/S^zJI;y{i;c?),[#6̡0JGSQe4C0>4Z5Ge j+xA~u}k_ :ԾB,4@uGz:,zBƍm\r-@e7N ~ )/л#ޗmW3+^e<>VN]#4ǨڍhX)kۍL fyVdzԥ!BI%0xvSNdO,. Z`okŏc#!; 1 CE氐+BD1N{y ȌS\@. ʆy_"i؋qvG>o.r}m[֖l UcFơDlk.F5%m70=~XHm~JQ-cIjLsN̎ Ȑo\1%ͅخF߿#m7Nc٬y#:F4ԤNeӨ9:GX<.KM˹B#'&2qkc.6߷e1L,J\y"WzخbvM׍ Ocm~R!m*ܑv#8xsGM'j9ױn$GjˍTOȉ}w[|? 9dZKbYq2ۋ}64Wɨ8Rk!9{--G"T=P-9I޶PysgQm ˚,5ś;[סOMأVdvR+ksjS^>%\ܲauҌLXʊGKlERl[ͦ1|T^MG前΃C#-Ftf 5L=ɳ6osLD$yIKEevkp?bGݴk ul[l飑I\Bb:)V;k)d4k62|  ۹v蠟Z@,5ޫ!Άg%8FkZF#$w6hd8,BCq-.nJ?ݿ"FZ˷7mrYưٻp⬽ht,pmB2@3SHq.:60m~R+u=|#q ZZ봟KB#DY4\ia~;˻mLfdK}< q`'O t5G`yLpwbW#-6 *2b=57IƼ >ԯ-m[N#2"K%_m#B#ϱif 3r8Ow-ʭ2[;dFHnZEnv7wbf+f.3 vq d.Q: $ҞRX D,aJX-eZs9] -21 ,HKb<đZ^Q49֦ԆiS37!!U)UzRn Scp]umZȾpWxx I'- m2X Fjh:<3`HKltzh OaqrYqq=ivkܪ`rq#k{X'b̀A6[2K6Ak [c[=ZV0eJqoj*x6&@ 6$6h#ZZ&3BVL1ɠ7^KIVk+-͏2^&5~uIXbw^gT_"eg{$1j$:j6, { kK iwkoh&I s,A120tOW)UViLV⶧)pZ|kvR1NiѴ0H;] lQ)`}acS& xxfY!5I'Jc.6^ ZR1:(_H#N"\J\j8t-mܸ(~gJ#/`s4UG}DhmvOI Aڪ.,-?hJD7+}I|)*EuޣC'FMYl |:Fj-]b-xlM4f'67r7)-V<&dIpvbJKGSQ#sk] C&!U5}#iyrؤ sxn V4MpD(Rs_6;G}+#vHړ)L5,dȰL&fvA]LxR28H0w.oas`ntotC%7`g\"K axmV:.>9X_4A[#6 RdѸivSO8/dBd7X⼒;⡧5恶1ۏq䑠5[m-?:Ŗ &IRfX$gDYsMUg恱'isIػ{IYMp0DA,G s6l-HG}1ηɪFSMԸrMP~5I]y@Z}A=n$5D0lhR:Y%4xY|ʉ-;*i[̖CVBӍW֭)ںU9BBi@#4vM5t\~"lzL0BR'Ռ5+t W*aFp`߅*JF"\<(k55:ZH6EΦ TltVq1ln ܀TLɌ4UWzs酻Ah;2-EZZf yc<4ܞ7e99u:l͚)֖5X;<Ԓ]M_!. -'8 4#ZI<]1ü 12@!lfǸ4׽ebg&goDً]ŔS}a@v19%:-Įρ"|IdXc Jm ǬI,rVRXYFMm L3C&5ņbqA3ruY|؜ta;$X 6=Yv,=ʔA; ̷'֑E \4$ѫ̙L-̙# Y^cS[ ZȦg byR+G/@!xPtTNѮ6Ճth&nytc_446˚+[̊mYc׸N3͈@k1C䝻P Zs]m P0!X%Hc"ږ2$adb;oDz(F 'we$V^8ى^N紝grO2MrZ!iZ;9ŢװXĞ>FX0 (XJ%|dn5³ ncd /ntަ߽D-|ZMx2g}~{{]Y{Cx.C&`( `Ƚ.זrwv=HM'. FntbψՆW0*խ (iˀ^Zi2Jl9K?IpB x/=p" r딓ClWjqxd9< 98i:M+Vwr]~>b:&]8Zڰ $n,#1_m,] 1iiq7]x*0t%\ߧuevCҳSYJm;ܕM\ ΅{Cfb](㥡mQnݻ rvI`XiK#dasߺ |Il/i#QAq7F ;5۪/w AGHfAa lױUscGΕX>by!Ni \m;L|nk f:x4e?WhY$Xw:O{ikORs"SCq=?88oc]]bj>q8!'mӗ=2ciJ\l7<,s!KŒp|Chٷ|*;JGu;l\I;=٠]*  GP`2ȇsd-ڰ b ΒnbRW2-D2IKaZ#w?"x{-:d|&iE;u=]ao )S̆h0J\^Q5.ؒ;4xL~c @+|B}߸HJl4X#k !kw῅Wk{ˤ…lGo5;g:Hu5V9Ц02KcVܭ:8OV9V lNv-@9&ۿ{99HG;vɤzə 5hhnǼ WJPWE3=CԺ^}H\~moF ЄBi PSM) FFh;~@5!09(`ST%֓ N(` ՚ 5H@+vgm8IOk m21\Vj۱)Hg82;Hpm{ :GKnb^yN'S'270t)䐻ء dk86h'؝PWskڀF^ޕ6\Phq%2Bˆ]|K4`"XCRl# 6кwטqK'`1ivՆhw<Ɛ#\pls۰;\RlyWB[(iCl96ڏ7;\|k1澃rEv" ݨ7АԺ wڅ:WkKcX]S<pߵt Û>#PKX7aV0q,ma} fϑŨ@.`Xf\}>s^"ˆ,"Sc~*Ka/76AW'(~ >kN!+:ԍ7-ɭEUYA< !ljkIA~Y49om5#ۏBE͔\x'yn8TlFNH*UvX^7bS#zI6ɟkkH}2|e<84Ũ +Q->Su i|)Kh#HmgY1$}cKy7(:2*I&Y!t{ Y ^Z7Ь_ GH[WmVآBς,;Dd^?)?ьBnT{! )Zu"8u!<[";ޭL"/t B-V,b@ɣQ)J nO2aM?ZVc [vSq+Vr$f7Zkv٪#uոYb-ȚBoswnp%[6X`045  7+,O\Zθ)iܓ'pl)*$uء.` o+Ki$E/?ԶBO hsCy|?2d{mÝ1Ϊ>iHD7չT,)饽 i3;R"<+ÚAw?9J/tbuj\jƎvii@s6)[Q>FtҲ@j DN#(Ǥ) vCXbt AܧDkئyr,yfPE<.3R}:z1l0C?%&A rޗ1ןojXΐLw1.;2XtPk,.pɦl55֦'"#!X&ˎ9_XywZI2޹co[}BbJ> Jf$YJ cu:|v=}*ŭ-l@8\̖F+8qvo4\+F?*UbUT>BuL3vFC G\M۝Qn.NK 2D<Ǥttf0㠛-I*Ge ߵRtYH]B\".) v aN%5W +5(n]fZ q䚕!LsFDgsڳ~Ϲhґ7K`'ԳHtZ#mk9j~eB0w$hKrƑSlj=V\9.S:m TH0Z@1Qk@&6--(贎U8Z[k(`[IRmf_ |MUUPJnGj Q˄s]OD;`oD}p~.Ca؎DDy DfM`8Y Q[)cbk| ):G_dR8GNpgHcg&r= = Kڱi[d_\l=`=O\x֚+-=Gaiivc -;HǡqD|]+dtdxgaOt sk{ZE$tD<Wj!ˣ#!uR"[hnEPHVӼi(VSw/ :FjFEm='f7@ͥ4khsM ^lK{B5#|RzR^Z(s'e!(L&Ë\wޔH#[D3 {*KZ?KGYvmBcHu߱'I @}9U:8&4(zfcA{hlA=Nmc$VF:V:\h&PcV1 ;K-#⸕W-p FV-sd4Y$߳tݲ2ul㣸< BT,a,`BB! ,`J D%B!  ا$F|>O&`Ln?W7/9qJ)柪hKMl^|%%=+~TJA3HuvyJ`&#IgښƖObȈB =h+|T>VzޛXX%߀ǭ˜`q_؞BA!*":9cM\`1]rbkܨGryC⿵BsG}bn$k \)ޅZ8cEKk*("/h冀4Xp wДc7'[OxV"64tCu=xd3hn+][uϥ[V:IM@_:ss(zډJ1N~k{8控1_ q# AXA+d,-4180ukewNxauqU& w ұ|7UY KIp8_+1/kthm9nY>ΰJ1q:|or1G̭DZ#n8${1]Z׎M:d Rx۰cl:܀$r>>V1ux6\]` KZW`=+|[cf[s0؆V7ιCw)rtlߣ{Cw :L*JfoJ4AW(wfJ7s:nֱkcJ^w$;S6&hh7OjLFͤs-w%c 3R1˽ ҹճvLBf=<̦s#)@ x/X̉98&{~O~E&T`f*P H%H R"`BT aDB! D!*#Ob<@7w.R]v 6wJ0NB{j @ݤ fLtoppaTʓYy`cַ4E{ Ѻʻ7T a@*^trcIkaTL9RHt}xk6fC9,r4f;xsE1c+aA$4+Gqd;!0g~gFM\qnwP\ÓnQM5( 4Mf8ysXlW?1Oƃ/5iܨY-#qDYx8,4l~NZbscOk,|3;WF!{de4ucI1Hy|WvS;ѼiS⌎uehqGFCŻyu;ڳwyBc]Y{ @Q wD͏%fu5̃@z=z7c& #HH#}ah12FL^@wS G-Ԣ:|f9#K+/p˪{c^6sZH(a%x;jh{#m3NI-sCt(+`-kԺd{(Uѡ+)HSGlk:oW4J߭yt;=<;7Zhޞtȑqǘ6{G/Z!H%8hof˯H#Um|602 h޼={z?'div Xv?1LouDwJ`$<\9:[E4Ǣ7v۟uetqfQSGݞNc ×$:#,vo]FO)g}ac[^re3 Ggbc,\˼NMuY4t]"ӓW$Bli cE#_?Y14gV18+7sүxa=74*!|gd}|7|d?2dKm9/~>uW NYM+l>삹 KBABPJ T$JB! ,aP,`J&PӰAu#aal7f{OК8!X¡XN6`yVQ Mn#@ڍ3<_'SDb0ޮcIU)I#Z~`V!Ӻ%MrI`ܩ7#Do\J՜qRd'pO 5*dk i΍QHacɍC"(<6Ӧ{ +PĜlι%ѹ0ɵyآ 8L.coqaWBS#tI6'#ؚ \XIǂzuh@]#'SiQ(&6'J ?ՄS q)P >k]qiv\ aՌ"B`)XƗ{#*?svwHvsbJ` XODvGjT@"@gYtekAoWcExlr7RLH" R,bӆDNyK%7$>cȪ|FnSM`4-`8I9Ɇ!"p ɧ-Vc;pA6ݨ "#>uT]<7JU(Wrq燶2}:oY-*XR=PXQ")K#\@$L sەZN\TZ}e/I ;9޲L]lj>4x i0Æo"I6lGg+>u+h#i]XzLbWXl>}txfL3?D-taI#vBN #e܉szDq<]!ųtbY4bTe 8Nck $fvh_jyԃr]~D Hgt߰A_eO乎H,piϵ] (⬢ 6qIi\Aa( c|JxxqeK!kZߜ.p!EGr4$vW ڟN'Qc/t%;K[* {x{|F Hq 8>ZfAݷةy%XĘn044FHh !4{|4D{VkƑ͈Y'J.0w#+>Wa<>ӹB[\FY d BHB,aP,`BB! N '~Ō"u[|M@¸HB%X=O`I2wGt!p;iƈ.?ijNjn+gu[X)j L zSD.fX;zxpZ]g+F!Sqx{X= 6R>0>՜BNk>WS Jy- ocPͶ˙1tgC $x93ߎvQ<ʭ*6sff'|ܺnQ4Ra?GŸ֋(Wi{@Id[{D5Gy'\BB)ǚi@$Jc8&-CPiV7MxMsb.Bi-F p1\52̮#岪O wlČ$pƻ)NԣsNMӑ@Jw6+#9n!;y1Q( B!OPH DP]2_ͧv8`;TXNn.6YvYp!*<*.^,saNovR(-e#*D! ,`BB! ,`BB! ,`B `BBswli*eklYA٣"1E&FKFJNi>188cgϡX !cX}i2d86 wF,,m' 1B0!XN gaލUڱ|} ';;B0B0!*eJRl ʿTsB6vb %F<8mnFׅ,ԃIEq.l,-ۈ#; C揗uȩRcN] e}MteTϻno1>.%Z{[(9 e1ܜ޻O>\$n¬2%_-Jpǂ@{h+ACCGF%&!=p'H%e؉+ qVl/PpۧзXl;0virc˫BIrAڕ {dx(̪ˉ`6D7a|}_q3\>6ª1g8K'D#޳q&JNJ;anCp!i ']}?%uuw_z4٠O=X$sJkuDƑY5dЈk\0[h̒Q[0Yؠ H#Sc(A!H޹qNE<,bZWA;F3CxNN:qUqY@G;OևKA(S3n`Z]&jk8SMh)t∅l pؑea<;.}N1BӿWt#BDx>Cm;r-տՆUZ] fs(U)V+M8b!-!@!-"0KJdžl'#aZЁ.8yۢHD!-KR!J0it7Ht|r'Q)Aԕ s %\cu{ۅG#:8`{M3#ɤ䖞c~G̭l>2 ,HIzp4VP0Λ-7͡8HBT .Β\_{Vfj#^{?C{7m?bLu=ƛd4*}wIwc'g2+cZם]Ϥ3 ) Skev#jpeXNN:x#C,}IDζT6d3aX"4ݝx<(W # 4qu/~ 鱌w3hmv N3d@OМ= A9վ[-7Ǒ9ZE7ʾ˭[u?h}=RTvsp%KnRF׼nݼp!l@rUYqMi@R=dltڌX-hJ;K.=}h q]EMcV'{ۈdi;̓;F#⽋`u:ffR2:v8-p7 #U[qK7+1\i'p7ڹ|t2xFS)tn p\؁jcOª*u; g@Rx FLhl0.}P=#9N—xc! թy 1h^Өju{vⳆ04q 'ǽy- nAlǽ gs6b\8.dSrw-nAbV\C&l܉2e9;6@70&{-[Enpdhz&cH 5Hk[Ks΁[ [Ȋϡn~v\*:`"K&]2i˄tn-p ` +Ebx$XsOZ4ޢA+ s.sń k<QJvp*HD/ \bgGrY ]C#e|m>h}LΊ>HhҪ+H'UA}8iV>NnT%wx$R<P⑌/uXhnj  Ɖd8 %վy$0A+LXl̓on׭,K,wV[wҶ5 vCIHEq k:$_jw#<Nsg[zGA5U_ekr&Px[fJ4[n TEG::*fiI_ljrqhV{ШY]CUvyl+dF&IJ[jSWy,5)bURYEќ;- \jJtyFf4^tO%c2tN&+6\~'ҹŵwFҫ8>}SY6#m]2]5տJJK){䏁9?zYT8(WXB//QÇ!hv*f&`b3*qt1'O` ; 1@t@vLXJb!e0aH(tui3w4Vѱ,pofܶHlv#`!N&UtaldNB8&yKz:@ѩI(k\]@J!09QV+L|ftncQUM!f.oSGqeZT.WyTiq$W5InwEA,|cq^u+, H ո#X @޷J4eÍn.+oX Tl6ڸ (6]Gy KټUv]3qq9~Ɏ9B:% bߔ5^;3 LV1pߖǹCle;`zTO&ZFNǂa4Ax:ld38n4iOKgbIgb%5uj,io$䜈++&f~kRVWfBIJԹ5iĮ[3lfV45Н[ Kp F MCZNo jvdnH,sk9u.qšSym**)-c5/rX?WBSc p4kc\P:&Ӌa1q5e)Lɚ\cKA3\Kޚ)46ifdK0>Ty nUsѼxKF܂S(ܗ0ׇ7AUll&<5C,\yR5#$[*V36Hc~m0LV*Z4gE2KkZKGTjXb#% 9yػ]2'r6I;J7c86g:ڻv%4Ցb$7;[,"ɪ0Z=kwX  j i{[¤hvTTcsQ7Ε _ Ymn$d9ڷxK'2VSX <IL/nU\b4 iZUnF.M3L#tznZ+UmG2km=`F BX>{#1f GҚ #INaIji%NPs݄pA@Ό@-4M04 TQK,n "cBij~qrfQǑmݽ`ocw.cib]=#jH$$ &}`q\hӭj o@% FR@V6sCflUon ֺ`9=!sұ'*,;W`։ fWKh-&ǁV55c*&,rI@X 4mW*zVW}+E$6׳yWB,Wl"e,EŃX#b4ۭ1*"^9{%{<l|3.t5.K fwmd7τd8&꽛]I?ݿ'Hu /udC'dc@-:yɪA{IA4WE+Itv kWeUĵP󽖟ɇ5jbU[lVi;sn% ͏,1liu|x",|&gkk K@v dĮ:>%[4$Q‹YM# h;_f7!=p 'yׂ&oϱ%Doq߸`'=iRI0gBw;,H~"T4=i]ܳ&7 ~IpS\9Nd,: I;wx~9=4]ڴ8F#/~ |#S-Xrx1Xbxk@9lSo"Pi;bP-(ؘ7k齼T>F߹e.xv1粈]r F땆`zy3j!BhjI8&O\H=Ķ^X zާ汍C Ry7jW?Zp|_fHH\QwaBByK(&qtNw xl3%Fi$v6QZ9@ k "3ekuOZ ) IҐH;49J9V[8lkDr8,6Ϝڋ!`l1-Rw5wW4#0 CI;&۲>;}gVp- otNiBR@T9xVPu7ϝ\HJI@R7 \rH@[ObKL ]B̑<1&S!/zts zʘSJٝv6\$D(v7qt񖎐] &Zh=f?Jk[:E>u)]kXܓ; ɭ䜊ҳ<3 r5I]$V~Uw%P!=F RjXT.-V[Y0|R.Ǎnۄϻl#p]┞G>S$C łl;~ThX>M[.ٸl,6d2O>H3FQp%nc#+\AbU:a;q({ufv'}O H#iv9+!/drtzA!6EcR ӹ,t#$,sMA㾴nӡ;u80 $,ڱ8NTf84lHs=f\l1grV2HOLbGzlйH,@  Iĥ1\ɼ7ܬ e, , 8gFbf:@"Xh % Xm`kHP_uٱ=̬Zfʩ}Zisho)<Ws Piݜoa))tn ;qp#+Ih@~o#sܼ+P7 >/М1[~.ƴ` "+ŢdG)sGInkuA'|.oԕ_w+o@>o۾e¢ܡX^; U;sJ SwH߷})WR[-k%j0t?[︩|5<؝4ݢ`ZN?]!yHZv\`ܩ4T5ֽ͎Cp[uҶQ4gY?mBHx'Oc0̭UcwS%K\6~=őc\%fldHXp{hd0[#uTʅ]`7ۘגּ6l>9};)LL{︥:Ab.Ƽë]ֱqwP")FXG̝EAZfD$X-]ثzՉU:3w1GΫĶc౎}Cs>0,?)Fgd#+W~c/WJ;KGVfevy_q\6Α/c[[bc^m}vޠbT} gkr+^`l1-.>aTԾh TsPRwYºWFݭ&aֺ5Xrh"5I*+[{L ;9sdBdQ:$ Dn`~.(!k۵fxl NlTf"K;NF8fMS6瓰=w$zf1į&4 AvTl :ŅճW1 s!eJkOU$AP1yhqh9u %I(25Y$Gn@rQOtgT)= vAעNa'ocS/֞0AM0Vb{ͥ-2}0%$DN+mu\h@i忙lI9j@!s2ip%cuYQ1K0n@'#;1fYNcMoX@Qq30b5s^TִG2U2>%WEsx[$B37@Q.7jFC+e6N;mf*j3TSL=ϳZ{Ҝ+*e=#퍻oZXK[4⻑@v$tB!w!i4cObܔ(o\KR;"C: I2:aBys=wМZF]H54@4tm+ INE a@e9(4W@JE}#0s' @טrR޽K*ܝI4=H, &D\]PO.ܓF.i; 蛱=Avئ+vPN fV{ie2a411 5QkI=-8hqDQߩc0c7B:(+}AtB0kM =)'Eoԅ A}R!tJ!/Co.Z 1x7D#9a?P]gEoԄC7B :(#~'1/h E! ?RD 6HKA~.t,- F#%n4 p{Ȅ~o=Ԑn[':A;vTxN#n2 `ͪAԒ xݠ]qT MaBkһ%#}ے &VMŭѲ#wv+1 yc.W(Q;Nz7o>eą,3_/s-I-'Ic#k6}LxlnA| h#N@iMf91UQ@;ʍebcMUvx M.$G0: oM̒w]xd%R2D{i @^TP|˷I H0 ]Q7]55hw$pܔfvϽ$Yo4ȶスI TV .Αi.4z29ilXz|kM4R1HxŬsBcM{,USNq/jc%Wvv MĸlT3㵡(ٲGZm@ʇ|ж"r?.|.忥lsbqKmZ{Wc71+8!}䧶ëҺS<>TP#lQDy>ℷ{WX|F: ^cҫՕ'ѾbC:hCqv`T9m6<>%!džPm#v Wy! })$n @ŰZZu1vy{4\9diČpO,v SNЭAlxhe>FimEU8|1ΕP.s]s k297cuSǒzM:li|:8zWF9Ƕ6tl 7T8edI/7H-x#g~!m.)u[Tp+M\IPϙ#Zz#6Mqø 8Y2$ ŠVNU-JL57TIUSY׿N-[$goJ ߔ8(p=[ USQр7bI] Q Cڹ?-Ku.o_,T5i6V&纀2c\V|7ٹ  &LB@¸<HiOژ6ϺvSJP `qJSH uKE7YJ@˘O|M%l0ҥi@aWyC#؜ lyJ*"RTm% aAKi)QF  B HP>}9'0ߵ| 8%M {Q@HB0%H*! rHBDPRcB0!Xcك{Sc|S0!XƖp -BW0v?F٤B4v@.MxQ(iV!tǔ."*W.F]UJL݌^#<=]A>xq'ա dycOΪhl!{*#+x(y]kۏĞ]ov=lJ^. e YGw]J)8+s:CZOʤF/I=bۍEUŮ q vqq!am`S8s*ţן)դG}-ZzY*{3#7Ț ssy ]\)C44M5Nd pk]^HV@n9a Ni$ذBd9ʗv GvRmk x.shl y(e9ʵY{c}M8(9U9_IRb9Hm8Y6C%Pk+{wKj aPӭէ %hݠvw(kMub#CG/R7nk]KGx۲A q1$ @G7$[iGtsSwptO} kj/s+s>P#L0o[޵@̈+];\,B8$0=a=ctntxZ&8ϕI9nCi$ 2zU[0w1dݘ߭ě)#l=W;dD39Ims<,[%0Z0#ͺgD5YR *? cFb"Q-|zit>2ꦵ<G ~U#}h H ~BI5+^6D;`YdixSgw809dHFmw{4WsB~+eu <{*bhܷ͎݃YdcS{!u8y :=*i4^7~mz )F}84 B%2x"}H(Ӹ|!gjQ;ݻht&`zaִz:h!9d ׷=CCG8{B 9I/7̖4ˋ/ x'Mg{!]:vq%ɏҕ^4c<U~=tlvUܿ $$mDq}K1k Po]f1ҝ;ZCu)%mW8f-8g[,,7޹Fg7.q޺p:cfk\n 3#9c#tcI~):&FCe-+Ճ7p=*NX1,40'ui]$5'rnLs}GoGS)Gj& ])( x%6@Nop6xv Z^h !}&bf8k@Cp;pv2[)6 [p*V2b]"F]jT9n,X\}Nt̂!,Du}ITjUkp2^޴\ǏxP`#n[ޒ <5s(MxӠ9n1ofxokqJ)`o˽!y-uˤ P$ߒ{l^nՍ#;c M5ۺ洍Q?"#VȡJLךY$xzDԞ%hpھ^(șm+qa}s,suxmttbn5ߒ=I크׻럀 cm^1-1#%o{)/i4d܅60o&B'6 5tyR5zA> #98J;^$W|34i}j]{]B=QnA-GN9X""Eu~O<ֽw<-?Ƌ6;pGFN4Hs\XcSSVmp:ڧ7bCvrڝ3 |cU&6L hvc֦ct3Dyn HnBZ$k5j~ôI :zk/zԁ%*ƃAt/GХl/ vhGpo+/H|AVbϹ@|2֑AqE\E%].Xcq`-ӵE;!fhGd51 ׇ%!9F!KkYѾ)3g u>=U[pe)ݱH  %I3yp=^ˑº]-lOո(s饙5-ԗ) vHUa_֑iUϵufD[#lrJ2 xo7J6;Y9:Y#>^#%fR shxv kR6djsـnҘr&,X%ͪo-f;V#C{*L]1(s*>4 I'[(,#rQ9bK"G~[\{tbJ η:  ch{M@GeN؜i-qv_v'KA#:{G Ku- P34&={ ] @.LoL2Mu`#$ 2p|.Mi47Ca#py]LU5A\!;/:8Dw;BC{W78m˳}k߿5>IeV˴eE \:1B>t8Uw%p¤{rp6i:I+gpOH}G؃Z*g9{Ya:8Ut١QKGXr=)nh( 021uۛ}@mT~]8w1 C] %wTdsm?Q]9è0)Fs.1n<'2)e3`Cs^݋uv*c[FǍ{*H,3DQ.V6V$cr fX \@>6gO,6[$O&5\Ț\v8P Q{[{r[Սy !d<ֻtG|n$Wms d.wqp0=މ]Xvu#vlӢuI6kԐHvj6#r58e%cq{.>544;$_ Ѥ@Jns) J2uR-G%@]Ţ6+62:M2o= a:64mGs$P=`*<&hwsET#Akg;)wYG >D(#1Cf-ԓKHET!vKGsy`(4Jgh2 B;w@hvYJgy妼ԟц{3@{X- 9bheִ'igF^-(0Os q$D{(r(bҳ-p=6wWfM'£]hU!K0lg,ʜ+I D巙 l(=S`z3ӗ:+c#bKoSwh!`bM zhro%.`)-w=48dH 90&iFdmezSK;J2lVvҊ\fv;JM[])7QҎd!#9|-i0 >(F-"0ND;}D0N"0w-oؕ*7[sJAsxq GJk)ٛ`|# pxYKT #n6{H , <ՋKOqiJ繠ipغ1c o.cUf:ĝv$W"Npj%Dg8Vڹ4W޹>]{|u ୯:ޮ\íiTrr[ٷiLtZ[v9ånV5#։Š8ӥuy B06u.O$\;rj :N XXøsxv~fk,M&|0nhdPcЕ'CoWQHIn.]y}p#p4) _N|l"߹'09ǧ-dZH#n {clP;+m- mlB VDR4Qj~ZN45n=K$c qKt@<7sIqiyޓ Fɘ]^=w[3,]nhVjbэXnMi]6u!`3W`I-緕Nho6j'+ ;w.kFr'D CݍhNnlu 4ں4. G vHښA>ޒtnqW;]Z@ <6Q5DlVƃAI[DϰN?t]b]dGCъcoiDѻ:N*T!$oH-p>܆p[PwO!|X 9RiV|;L>kx=)z4#WZNRH{χ+j{B ; h~/C|G!wa8ۏmPtR@IkMh;uph3H{:}*܇DE)oHntl݇T~R Y摙'&֐aJG:tmW\Ϻ-ߴ)XO!k5dUU]Bs{Z:8GBH; "43y^']z{W`UߜG!)4W`[Q@`K*Pb#Y'̚{ KѰHcbJ?b"g;=oW?Rv^kZhY9..߽t6#:Ҥ:ca lZBaK ;ǡu@ꏝ [:=vݽJC'vh FWȀ֞D;} DB̌t?z<ұ+2x9߹8?R0yNd#~>t9-si4 }WДMaRikx с5%w6іMgO6 (z`Y+Iu[O"ný!9ѠZ'ڍ/FzoGWk$l|\DM}eZh-|/Ð#$7u҃D.U{uӛMִfuyeBt >ܐoGHFb)%@Ǘw\#-Ah/jJ*pu9- K}hZ@. I endstream endobj 35 0 obj <> endobj 36 0 obj <> endobj 37 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/Rotate 0/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 38 0 obj [39 0 R] endobj 39 0 obj <>/Border[0 0 0]/H/N/Rect[310.75 266.6 560.0 60.6772]/Subtype/Link/Type/Annot>> endobj 40 0 obj <>stream HWmo6_qf3MRuHe-b aPd檷R"[swQo7zBapL>L,&K\(40]b5a(~'J##ed&.&(|=(`{ԞA0S'8 #. SBcwӛ[lN )䏪^J΀"/pٌgF%xWQ*XB"Jj?9DfT&vRB; ];Y%0;UIP: pxijj01bd+;թװShѓ^S["-5:/,:Rɾn#eob<Kպ4$!Ʃ1K LwzU|4'4Lֽ 9JG`iD}~b5Ap0QQ%Nܪnsu3.и˃Mׯ^/˅ԽR~kxsu Z[v` mPvZ>7tC& 7>o5{^ySZHGnQi?SxC"x"fmΊӊdUE=^Y# Le5<Ѳ  GJSnlҐx;#' (# RB9M88 pN1;J $¢va.\WFcHRcDKD`y x˼%D#KwIHtol qL8'+ OX^14ΈqU 9<_QWj^jT૚{rbΦyq瑵C  %6p襸F?!71)B}t]w]cZWFXDR4|CS0Uןooz4P endstream endobj 41 0 obj [0.0 0.0 0.0] endobj 42 0 obj <> endobj 43 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD^ x Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?``0 `0 `0 `0 `0 `0 `0 `0 `0 `0 `|a|l?>_:=MSA穭5̒I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I/]i㫭z^WQ?>uGCCbk[#GX{u!Y󖱖V ({=:z>ӥ|?<^ G/Zعγsu}k=|lelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelՅէ g]6puk`OQ|?<\oQk.[ݩY"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ,H"ċ;=g^s45R":Qq}׵Wl]f뚯F<^ W+Z9ֽsu\W3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w3w|j]ӉDl\{]ظ:zu_>uWCO`hkG_{u".]󘹘V" (:Zѧl\}-'KU>_:=M'S\yjki4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M|M|j]qxjuu^#bؾq8f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c|b1 endstream endobj 44 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = Ԙdx"R'H TcRuy$74&<-Ae~>ah endstream endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj [0.0 0.0 0.0] endobj 48 0 obj <> endobj 49 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD^ x Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?``0 `0 `0 `0 `0 `0 `0 `0 `0 `0 a|a|l?>_:=MSA穭5K$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$2L$|d5uzu:>uGCCbk[GX{u!Ԇ-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%KX-bZĵk%ՇJNqij<5_<^ G/Zعγs}k=|ؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[%lJؕ+bVĭ[;=g^s45R"&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1wE}s_puykYi8ZѤ<^ W+Z9ֽsu\W&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnɻw&Mܛ7rnWztn^v.qt^W>uWCO`hkG_{u".bɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L\1rbɋ&.L]wwK^q͋ѥij5_>_:=M'S\yjkifififififififififififififififififififi|j ]q᫦xGbؾq8f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c|b1 endstream endobj 50 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = ߤm](˛Ki#u+EեC 0i@4&}=YX endstream endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj [0.0 0.0 0.0] endobj 54 0 obj <> endobj 55 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD^  Aa !"#$%&'()*123456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?C `0 `0 `0 `0 `0 `0 `0 `0 `0 `0 >_:=MkSXԆԄI$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$KKVVWZx>uG6Y!i{]M喳-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-c-g@_Ck\Z<}fۅaMֳ`rjlϜ5XhzMnqw;omXsCyJ%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DħӍ l#Y]6uFz195r 5u7㸁=G־pL& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& ůzQ^u7VtބG95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5h Q{׽(ίa5t{ W_95r 5uw㸁=W|4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&K_jI]#pj95n>w;oo^sDyL& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& c_ƈ6߮a:c W_"{mn.M ]5m|M/_]qj>^Z=Ms[rjEyjF||'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'ssV+V#]xj5_Η''3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f3c1f77'ƗƗ? endstream endobj 56 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/22300040W0B#s3=  PTPTH!9K3@%+ 05% endstream endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj [0.0 0.0 0.0] endobj 60 0 obj <> endobj 61 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD[ \ 1Qa !"#$%&'()*23456789:ABCDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz?I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2ILd$$&I2I:2]S/Z6M3fpc 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60c 60gLc==3Gal=}9e6Mlحl٨њњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњњlݒ()&n];yfü4ehoب&ɶMl2PE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE$XE"(8lLDK1e]/]k N͑Fd!FG9 H2A d$ H2A d$ H2A d$ H2A d$ H2A d$ H2A d$ H2A d$ H2A d$ H2A d$ H2A d$!#${9FKeUt]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E,k/]k F͜A%!"E%ʒl{ ü4ivnȌ6v>"#uLdmDdᱱ1,YUt;Y%Iܛ6'g擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋N.i8擋-&*[*^tNxmg5p:NzeSE׌ɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɹɻvW3^"rgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&tgI&te? endstream endobj 62 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/2233310040Q0B#Cs= LR(gb`bZZZY*$r{(sr=d endstream endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <>stream H\T PWfmtgQS4(A!dQ~0@]2APF5% g!Qw50D~KM!˘Q7܇oHmXIe^sϽKr$I52 R@jM`eue"dN#N.^SڟTgې'J k} +fkub\Qn.3WJd5yTQ GrE.W7HsEפ25Mbv"=+;(G'ETl.ksS5t]A$` b A ' b6A:$V8$/'7R"ƛEJ:dyɡZ6CV"ϑR,ImYt}aF\U 7VK M-\?):hEb:ׯ}llLE \k>x~eDE >k(;#)='~˕ƩϿJL !yHP$O7*EU;f.qX}|+_^U?j> \>r `շ^Iyc}b_ǧnV Wz K1õʡg?fEUW) .+T.CHrs򱍔'R;s<}36^``Df-Q}dx HxJaG/ǧr8Ea ;S|&` @ -LYeH @aiRMk2N٥Ҳ;l[35X=Иn0 حb{nɪ7nJKC=fW[]SoA&cܶո]]u12ޕ&a]Fs} K-IT'tTҰ2 &`?,S_s~Dw玶@L7{Lā[]p@rF=oFf8'Cw;5"x_3%ÚT@v ʠL(,q>LyGtC>LE+lܘP;2:,uN Mv )j t<)}~Ǩ9ΫYeݼ^EJ8r]#2+$ |O hCiW=-P2^d gT㇛bFO,[|?<> endobj 68 0 obj <>stream H\n0 yCBj*q؇41(o?;:i(;NTVu`je9anހsbHۙ 70^ʵs}4E>p޼߹|*때8@n, iD/ ,wƘ?eŘ46| W!3BӘ.nȓgtc4gf $0dŬcSnA33 yG>M`4ȬA2sF9TSQNud>%1kVYfEu 2TKs/z\WS]wN4kФAs/zhh;ۑ8”iQb}W~2 endstream endobj 69 0 obj <> endobj 70 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ endstream endobj 71 0 obj <> endobj 72 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ endstream endobj 73 0 obj <> endobj 74 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ * endstream endobj 75 0 obj <> endobj 76 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@A endstream endobj 77 0 obj <> endobj 78 0 obj <>stream endstream endobj 79 0 obj <>/Filter/FlateDecode/Height 51/Intent/RelativeColorimetric/Length 1818/Metadata 78 0 R/Name/X/Subtype/Image/Type/XObject/Width 72>>stream HWSSW;!JDR7 j]K-ܗjmuZ-:U-L;VK;.nK^HH!!=7Dјw ;{DޠXF?|ݼvjo|{usNM׭]m_[a²dm [e~4UWkڲn'ꓭ5ڮ]ݸ}__߃o Z!3=KZ=m0)LƎCIdy²t17HYvw;] 1[{Nc﮻僥Ƃa@P%d%\H4 9۪1J$fpWxE'ݸر4eH\s#^W7?ă/+4o^0MU}iסəx%m9[m]ĨA"$1]e:*y^+h1{/_jڴ0($[ |ayE>[Z|ׯ9l|ga`TȾDbRFw9d?8l0QJc#2Vנ>q4it4l ^ͽW] }^|DÐ|ҽ=e"l+ZBM5Qsd/[CuF.=_)NweCxuNܲAyC`#VY^8G@?!*i2!4[u(R6OKowʞ$Fo!թ6屢M_2(mLqq{yzruܘQLZR|_9%d️6ϟln F0ZҐ\}Η4zi޺'}.C>A42F?jH:G6"-b&;T^S.صΜm`~wyV?cb1Mύ/Fpv`^Tu-6OCL:`p>g`N?)܄bd"?M~9elk\ǏևD_M$ endstream endobj 80 0 obj <>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/Subtype/Form>>stream H*w6PH/22ճ05743V0BC =0T01231624T045ӳ4454RH5Pp 0 endstream endobj 81 0 obj <>stream endstream endobj 82 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD+5"  u!1A"Qa2q#BRbc$Cr4 %&'()*356789:DEFGHIJSTUVWXYZdefghijstuvwxyz }!12AQaq"B #3$%&'()*456789:CDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ? lHI$.(A...$JI$8J]\>P 1ӼP೸sr\kyAyYq!+rw֚ւwx"yT"L01Xv5qu%I%$IB $PI$(K(C.(A$JI$$P$J\{I/WfkI$ȒI% I$'Сel|YuFxx!ܮØCnh]7Bwx۴H7$UH<6"Ӣ쥗fVL&fQrx{~=!DpUE-#髩 \]IlėRP]IBIu%q%Ԕ!ĩu%q%Ԕ!ėRP]IBIu%q%Ԕ(K(CRJK(C pDK(QĒIBIuqYI(A..$JI$yϪ. 'ըݦ<ŝ,4c~}d@(1)GuYUYN/iCRMNgz,VdɋKiZ&B )."8JI.C$I$I(A$JK(C.$I+ W8*섒I+(I$I$Od(+Q$l.O\@@NM}HQ ri'DdۘGx$\3E#Acث,TQaSikXW0ʽn}"\N9ծ hHI$I(A$JI$I$I(A$JI$ $PI$ I%$IB $P%KbpbV1.mkADJ̜\]IBI$K(QėW,K(QѸv5SQ\ohCa%%Һi5;,IӳDɕm(ohÀ#b-gE1r'0`I"lnn:meJW8ĒIB $PI$ RP\]IBIu%q%$IB $PI$ KKwʡ}I% I$I$ I%uGdBFh-$fD%Tֲ,)-ᣁ4yYlC|*aKC,bȲEvpB||3|CfYݚg:f*)KZ/"<3D )e`|-pʀeէWH]49։4Ƥ`I$8Jq%Ԕ!ԒP]IB $P]IBIu%q%Ԕ!ėRP]IBIu% ?N*RG:ΣCN01PQsKvѫB!ݰ8(#&, ~FKy]0\N+Þqqu% 8I(QėRVC.(A..%z@]\#Aa< Gwޯ?ő'Vd6)4˘̠t@5dOG6sLvx-;c.Ro2A]!o26@ٵRZ;u]nlMs4 iLIuqY8JK(C.(A$I$I(A$J_'ʹ|{T|2!$J8JK(C.BZ״Gt"v&S"RDlOFK nwX]z]%*Tr]Y{D&4&@JZ5ΑV.[ICT4-?JqX'MW^qϯ(7",D,})!!(ыqėRP]IBI$ I%q%Ԕ!ėRP]IBIu%q%sj\{Ϙ{R=eN̽{I%e]I%%]IBIu%qu$ p\] C2i(%]c y RP\]IBJRP]IBIu%*\]IB]I%q%Ԕ(K8JK(C4+|iOYvr(Oayױj8otȉĒIB $P]IBIuqYI(PF=n4aHعTGSXKFrN*s4yok'*2yg /j3bJQ3;UR߼ڥhs~<Ȥu?gTYkG<0z\}5153G?}!S%H?.멑aƀJPaivO{r#7شplXXWiҸSQD8Jq%Ԕ!ĒIYI(A$JK(C.$<]G=({RG=o/^*Iu%eIu%q%ԩBIu%q%Ԕ!ВJpT9B=Cӿphm=jɚAK089~ڰl8S۳vQ)8ryr^Y25m=GJt5%ԩBIu% 8JK(C.$8JK(C.$$?Rrkrr|VP+EiԶ8Q zgԂcW)KjWJ8ėRVC...$8R:7\S}@OP'.t@ԫO]w$]_?} TO_:|ڥ ~,l 'ږcV9'ߛ~UѤ7p8zj) bb=)o9 ]xʢh82F<\4={h'.C"uc ՕhͲ*+4 Iu%eIu%q%Ԕ!ėW I%$IB %ԩBIviBPjIԕ(J RC>aNS\j[׹ %e qu%qu$K(C.GRIBΧݓWB V:,9g77=b>Œ.8ݨEQ#vIN92ktllczc4'jrt-,xŎ)9eE1+Xdɡ."Jq%Ԕ!ėRP]IBIu%q%Ԕ!ėRP]IB$8Jƛֵ|V)ds[p Эs+vLr"qt#Iu%q%Ԕ!ėRq$\q%J!D)KI:Gz,][HB:K첸k@᲻.l i@X:T2$Z<-dvVأC@cN=`%9.:$f1a4Sr4G8;-(yFFh]01bⓃ]GtS&&tRSJy 0(5% I$8JK(C.KojӀUfR,Y(!Ѧgu..Tau.w=e J0r-=m.vpmÜ#U)\ !#@b->*ӛ E{j@oJi*h XyacBҜV.('*thh5$VdK(A$JI$8JKquBΑ@adUQ ШrCGv΁o-CTn:2gh6ahaɛ:qP. $͗¸g]qbTn!9DkA2M!4'C$ $PI$!ԒPI$ I%$IBI(C$I(CLl4 _~Ů+)ȭ1vf> %j% )+c(ԕI(ARi Oe= PJOh',%TF3v1zM:ᛞp4vP26ϵv7}D aPƛGE48@O3O^sP7H+WCogڇbqE6ỊԭΉԛ[fHQ4zSRɢ{Q DhtZLp^UbY P_d V'(4Ό} Yv@R@H5ԁ4ܝh,Qm*"<+%%-jr;`ڐ\`m5< ͵*}JY 0έo+{G$,i9)\;J<чVGzO'&b0VFm&YJV!푽}US{P @3jv12[6h{6Rb%`$;1)mkC]E 0 \r( zJGBTc]IYRJq%Ԕ!ĒIB qu%$]P >Z |v Xf07h7O㾩"XvuK.}LLʦ#ɀuXa$W5ubykꜬ })f![L5%ԖIu%q%Ԕ!ėRP]IBԗiB&;a<'MU5^KMh3d>ke8iي:Zz.]98L}ĝ?tD( (,C'0wm%mwuUr[C\Vd%K(C.RK(C.$8JKIu%d8Jѥ-x=Q+ڵg2/[ȴ%7.Q Iu$@]\PR]P^/Y&?=C*cq#ρjsȣUYd X.hR]2CDߝCUWރTG[Th9\hgĽ$3zz^PK+8M (*Hu`{s~ͭT88I[k-Ŧ*h\֎b-)DsrɾwϚI#ad,LfEVԪ74sppDVg8˲dzeGguƓrԘ(yuf'fjv!gX$;p5Jkqd0k@p|zb5|,-1d - J HZ7Mzx`pFnc ,@-270&Zt/z4YӼ7p’u.R(.kdb{7B%S*W<_@7S:v0љTE=D.6V8Z?<М Ni^T*m$K]IBnT[gԒK3F;LYbʓt\>R=ƟU?~|Z21 ǜ0]Tu43>"hmS@߷ZRӹ}C?˄佒+Ц&FsO闧W:NT8Qt=r +<5%ţI$ I%$IB %!#ksI+z|@:8Cvee/DA zTu]*UZ\{.܎kwJ{unZɡ$XA~.&g2G m/C٪Fg&vbcݧ)`b͞FA@Hq Am_܅(wc.(AWN$IuqB %Ԕ!ėW ]IBIu%q$PJRP.^[x>l[XyhoE5joGvR[q%Ԕ!Ԓ pyug66^0X߽=ڠ^i¢S0 { Yc%);؃aۯP>.wȈ:B;ϋRpn[9cm OO:EcæŽc7Z wu{N7cywM0Nt7bqr% %mEE.<*YRQ3fvɈ{ qLvsa7X} Kc4!8cQQt:?}Ůh{B/)a&(l;IV7efZ]<.E6'rHW4ygt"FQEIvRʢeXf"34leNk3v ~YcO8k\}Mۣ)EUIT=%[e4 7K/2)}Ѿ0vh9IR%Hhp{QmݢܯIo=LwN[;>0kQj b'yc0Rk#{z0dc#76<0#~[J9Hnv,[. "hRaӏf?jJ]G~#ڻs_]>|xӁZ%Ćt ,8FM6LE8w]2ڿk䏺z7X% I$&#g$K`K8JK(CuẄ(H=3ꚺW~7ꚝ(YkjYmah>wU>i+M>J/c? ?"'̟uԏV܍=z\H6 gyOF96C`_zBN^MC4'U!Cɳ3sVS$NoxWDOյ첥F5Tֆ u (pl-γ^b(uLUQ68J8JI(C.%K(C$$8Jq%Ԕ!ӵ-O3πhD\هkImY#msdcda׀Zzآ$ <=]IlėRPBK(A=TA$4: q:F1G.S}iuqb [<,#+C,$tIؾqͼK ,nat޹H=)602g>4k}QA[*ulpI 9sqmh( ]9fyN Olm҇v` _Thmڱ)VfR,TSX4.Ϡ4o Zrt|qΒC\5uA0=FF 6kN8V4<|ChbGF^-01o (24W}v&$č i>ai^9vcF>m;TǴrTM&*WߙW\iu50F;-& Mw#k] ҍM.c7].qkqOBq"-ȼ0rs;$<~ څsص_4>35j-S\Y2Fc1fcƾwvS3\4?c)ƌ |VnV;[R S0up#B}uFl<໯xE=!qcsS[FmJX봅jce18#9c[niwE!ཬi9rNStF-xh1]庀݇H&x .?L5&/bS4C##EQxL 假~Y"&էϮ^95fv.gͯiDF<9eaVR%PIFoOߩYm<[pǡc8нLE-ӵTs' \aZy?j% hX(m,yC#cq PsO<[kP{<3.N/C yF57ﻭq gx|OZ;v)ְp$nk}]}[q̈́Q@>#qˌippTNacZ״xO+v)mkޢQbB HST8;MLs'4nǓڝf:6Qaď€ 0sm?tNCzD{4PmIJ,8cē[Qigh<=־zQW!]u=+Zfy.j>cޕ!ܖ仯)"d-T5%\VdI$It(B71~d, s&==(۱V 3/Q12(.fZu/CnfPF^:}"o4'ꜯzm#VX?vU+u>>B115z&?q#_85cqP`d 9#k"i9c+WwؤN t \_4MC̟kW* \9[\RTJ2ni.] c SpXXtv :K;(hjbal.\GHo*`Q #G1E%GVpL 9s#֌ hZHsNjax8zZIŴǣ5%PØtkv0a Tb\agE?1+%#K:/Q`Sz+<&Zr5ScƴPֹ@rXe:tZcY,/noJ%'gͬZT^s/XsHf# YP5r٬W?q+|XqdAi ֺVg}K,ɨzUVefcRf@(̜1͏+bdCBkCǖpU3_l>R0㱰=h,oj.Pdy Z^#4NMP LJ.l} N}gǠ`ݔր%J|f!VCΐR 5KvPF>.vǂ8bl:p ~R@ Q[]c~Ηn4E93#H@" vt>sϻM[f# :S}cu`y*fg#먝M+< GAcw]j'xzܩێ[٨5221ED2 5XN7lQSZ8lE1B !<H "B챻@Uy[2d;Cۦ\Eg8~H ,,NcXG|@Z5UiwLsYqwaz@$tr;9nsVf,n[8epzQH%/s;FDְr d1xcQb"݃gs ;U\TCQBel@wޫ5fM(+K3)Q$F)B kڢ,ǣ#&gCP-S0g`9~ylp&Jg6^lyo(. 5%jo) >cv=_v}]7uJd/' Iq 6h a=wE9VG(i(7^!\'`ei̒ÉPv{A7]2әBuquZu;w Ԑ0yM> 8 cs$ng8`YLYJ]ϒ0W\Vhkز9cs2>XZi`0@쾥5P6"{2xn|n7y4LeGgpo.Uc>l(l5v pOS1cskZ. v!ºÆ`S"095(4fھ-︛X}Z(y/m;u!'p.]Et0)QHrߜPR؇H#)'6:% C`)[u$+MXdw94t]GQ~t9M:xsnUW8|Av`oG4bBiӭm 4^bvo}ovDi2Z`eA71'i-|C!kƹզз4=g Lb]hGhС+jWP!-9ݸ ӁO̊C3&5r>]l?:uK7KhI EėRP]IB$JK(C.$?שy@Dj֕8 .j 0f鱩.R!.Os(Ansa),8"XI(w.;pa؆;)m}Ebyq,)aI73UF c|>.0O|lݖXru;0aƇ5{9)KOEx؅|FC"3,nXZc컉s: ʐ t Qk~ޤ@xp=Jш?>H gvAGXFAhxt󆝦+228nU&`HE,!U.ʔuS9M8S9y#O,4 CG?ͳtO1D_$sb\F\;)ǼT-+v*GW$;HRO!ˑ HMB][JYtִg0zp9 4 +!6 b&umקb.s2ղv7j"B+4w-qkph\iK{t _W UyJ/*-r܋Z\kKC{6#fIQaqqU^'iզSt]j^>gOvd[w$OkCd x$hYuEv7 |Mp@]UIA1:\xfۙ24:ɡQB4-'6:˪dT'r?#r$mf[ ? 'Y~aĻL$4Sf6{NMiJc.c10F>%WqESl)=?"3<<Ӵm!X-v0Uut~EV}y;Zp"3>8# :*_&)l78h줃p/WDxI3C-N+8Gt&\m;A.iU$OQ(˱26 s ( 沢-_z]Z֍4͛;Hc;[ eL3ZܚzZ\Sb2ymQZD8K 9-+ϺjEfeq hӠ z xp]2g$8Y{+08Hz;@nozG5@@Z㔲yc,ǃJ[X@2-ރk% 8 +qo`$dXރG5u1UlD,H\-a P|BBK|x^(, @״hpkڋbF^׭1'ʌ:Hs\@Q8̸iFRͻF?sOkpZMJ4D 8M_N ac E6n^R7cgq]mDQM>x׋. VWVosN:,siMZ,RcsGFZ҉  lVW[Gqci]:t>~ !Itgt']t"x = :9_ { LAwLmszv!`7 1.i.l8F,w5d{ mvFcɋAZd YC]9de\Ff^ց>aNlI$3;B4 V؋,l򬔖d_#aelּ:.x +XsB&.҃gBAmpv{3& VW]b@ i\􉸼VL*07($ulg&z0[u+=<.k֭ގr>)@\KuD^eC"U2M+):~ %Ă7Y$]܆/ԣ)<41(XR3)m@'^t|h:ɛC)d{]u]phH%εe9D rW 4x=lG:DQV%R1nv]=I>n ;9B:'K;oBzҙCKgh6\VyP{2C;sQP"G$k[X 9!xlcv @Ӗ]hOB < 7tw@~ԵL w)eAh< ySB ~baiF}>t&M=QŴP!Օ5$8 o6:TQa \a(M.!4=;8SbX0qs\ lCcH^~ބdYw x2f^j!+ /5QsrEu_q&u2iY2I%Ϝ>#ߥ,f¿[Z[ڻROHZ#y~S+ژGH2ptno8(.f7YrO:z&F ^jOp^Z(Zosߴ\@"qDY:|ŗƓU M.f,:,)a4.9Lƍd>UyYH?GLkH$kޤ{+at =đ#bcMW1C3N5LbOA-G0KL 6שG!˦ ]># >'淲i7GNJiaFsp89tkFte Q%k#HmW9t4u0[*(f7ǑM:`Udbc=j=g Coʺ _|HZZ 徆W/a.L 7ZO08|S|A.Ca~zVCmGK~dv F$,cXZw֧ 9<{7_[hj ˇ m_T9am+cRlhǒ![3)դvVr{^sz:.vjm4czďm$1k&W\7 "8ڮnk׿lj!_ɎO}]zR&޾W;1A+ Yuv'Y5G Dǀļ )qquSG-88C sUd.3 iDǴֺNyRApwO#Z w%VM1Yn!~k,C4qwIـ}*$4hij Iu ǰfXZVعx:֗9 a46.Os FK>|idˉh hg-Z wj^I>lp8+Ҍk>gi@hm E #PJM7lHv%yCGyƅT7+yFjJ-[y׫7PG]\P$JI$(A$JI$I$#|eP:GHP 'rr#r\<~Qϖ.ėWB }evLm| :y\`Dd p@G$%L@1ci1"*b[d ´|AS+ͲJz7t1yCsgu5'dGͳ8 8 GSY'4pMGjfVwhg*xabdLm* ֳ )"Avb:@4ղ{<ts$nV2M'UA'0G<˔8PNUNXtij)G#k$2%i EG3;& (PndM^v7Z\dۨeΘ˳XVi>b=@E>2Ȉw.IjrĎ):gU9 9kU͙7W|cھJʙ"|#xc\l4:c^!,ٟ.)/c*ޛcr}C9, =jP/5;pbumVk-xH+jItXxKO8W 9}KC|8NQ'ۺ]oj: C&6I#9~}!|4:w'!!Վ9]n>%fX3po3nh")x Z~{'CYPSI\j;)dK[H'=(]ςv[ ,oQ)Pz~E)t-&jB@9Uoer7v(r̘޷i>@:X#qKB; Cz;HhkQVd; 95h }T?t͹BA5 !/"R8H/R챶h{H\dHz FXXSISէȝeo6pw> ?$oâIoq0@“b-4Xdf;oE=:jZ=AVy',J!dD3vPFM{vDln)쉹uqh&xlw+6Lcc!ffs Շ$hm ˲[]OMnFC84Ӽr:\|WL=7k'mytZ1qgD}x&5e]kZsK5"(N&Wl9i_0<.c_oњyE4\qXay/(y¼Ld2s[B(91U1A Ŏ~ѶuY{#k@?v3.j U1Esl4e'%  )!l7] >\v>E2ދڞ"cq홣RYQږid; >" ( !i9QAeyPkZI]J6I c= /*ńczhJ17fܠ ZE8|F+ִkdq:Sr tïpUcAU]q=%1 먐іhH糉NL{ʣoׯ]" "6V5կm1Ju 7A3f`ͭyS|+& ()Pd' v⬢'&VW(q /RXӏCǥجa*yn~h'ħrœ5iyY,-r1-2Ц =L擛b8o}1!-mƚr7s"vPgfXOQ̒L  $vGeGj6է;Xn$w2^vPqވd$ Xll%֝tRc);֍w`?g1f(94uB6 H͛X^WZ :wDX!yg3_gQ\v ˄YoP<:$5w0=[GE87ŇRq/a\u >uveFH!'ϱWёK'i=e(|<{WmZ᧘c=s?uvWZGq]\|VPI$I$I(J quqBPI$2z`O]ӫOe%b3NAe>wȧ Nt&u6aJ)ZWsÈO8Ň`%"֮4@st-iwI:cɎbJnQ#q@C2ͦ+ Me".e Qh&%+1([#:ivioLOѭˁ#+E׭c g>NXĶbK5'[,_d悁t9 uNw2Yw:Vd)7>}i kzk7I:h:!ȃC\z6t o>`wnn~6Hk[^#CZ1m_Cd O׌#duI"Ks_d{^N{Y  4H{2 KEإjn-=Z)FwPб// c[ēA{NS67 ٠zǝb"r>*~a|&֩ԲZU Y{( 4.ƹ ABb6Zrk_YƏ.(vޱVRуw{~D0|L`)k&l=a@4YHV+&!L0ucp~Dڇ}sD͙0Rr? g3+^qNXZLT\lAq-lѭP1A ,6Z&Sf$]n+ح9,Y+Q~Jkj q,tB+(xV~ZSm2ʣ~zv" 4y#6=# s+g q\.~'u4EX=esYᣇqhajTDego«7bvB4vc6{"E!n@ݣhm:~+c-i+h`;Xw'IKEyK55 ' Lj8 ՞.@k%tQ܍wGAUUpiXGΤ sap5#rqcm]'ateӶU1r%k[0j>|7Y#9 pw&r3"s]ov\+pI,mMkjq3/~g9;EZI7LZ#wܱa8;D^g}˒_B=u[Xs/uá⺬y'л!eސ*huСdpnt8f~|Ѿ4v=|0K 9]M+we)wY,5Ċw7T$sZ|U!E39{NS#s5R,Vb 3.(A$JI$ $(K\P$U5ڸ4u'hP wq 5>gYc<'s|쁱Ӥ:M@Vz<;+y ǯp*cIup\b80l9EQz1La{OӴ*5dPhp4w^H;YG/:AhpMƀr<}n-vЈ q8s3ԫxi_ \F%6UyZ YAbs \;LR1ts+^A ^UNo]X`Fkzۛ^ko+Ϡ*!#18s]kZicJ@Koqᠤ+ٌspX 殍lUT2fG'.bY6`,0ҢFC0l{ZQfwsm9'p⢘h94[QKd|d옉6,d<9Wfn]ӂ# g|5g:_NQY4AN^VlKNC!^ߪө/̓sY}wF.Ccc֘כ)X \ ᪅ͽrЯC7|6سֽfN͌>X )k1ivֺns?LOA(n6V"[3cWz[Up0-y||GbpgV-&;.jGhY3 40th8sH!ĐFe/82|݃Wq8 S NГ\;7]iZUΚAuBMR{mH) Ve=t9ϖm87>)[k,UTyFFoؕ*|-fm؜$zOjdr1ac(zɾjl1IwJV@xs EMpqp`spˑ{uz!ZbY>RUeu]wr ~Qa(bg}c%M9aƹsAO e?\<3`hqػ]riqv|Ks&.hQϷ6OH[/Ъ=~ߙc/4LQ:_(05#dqHrgA4Oz=JDL#I5YdmLm `4*MٿX0X' \K@ ԓէʃrC%f4pk5fP(b&[kib@k}Ir,Bk4.p8rx+\dzPWbPC^Mtϱ,GuwFuk@@;;['X'0:WEuў!SM^E3Vbdg=ӼjԄX}ǝIkZ3ݘ&8w7P#_Bw#KGר(I$ $ I% I$*qؑX|B_jSqĨ\T!gMaw\w*KˆAUI1 P11sGL wa_#b@&xUvn d$1ޢF e7I#ZA$ JlDB uZQ{~G0p׺A,+$Ō=x 㻏 #et+D;ܽZUp)Iqu]LAfyk<2"g2379ip贵íf9e|yp qmfyݖz- 򵀸e`uw7|?0puRDG0w:P eKN ]w B ֜ⷽ] ^Uk[JM'lZ014uXk9‰'qd-4rZ8uiPk;gNŽf1/6ߺ+O%`0 lNh6Uuk^kmc%ZC1:l,GoIrΓsѸEË\܎i!:F.4G2ٱu+D6LSFҒxMũ-5-t>:p뺽4(m֪n˘;~гSW3oդd\ۜ~ܰQ^[#hs c11;o%3{08g61z<lcKlTT"uק`.s7}zs:BqO2="<#8Ir4C u=+ZݗfIԺo^R"_?҄04 \uVeٛ$-hӏy6[o1{n¯Cl>WMP(W Ngrwj3;~Df#w*ꊡ\iA#g7Z\PWT~#ڛnW05c&xwQOhVŗDkׯbN6Y"1@t2>n $xθe˜;:ֲ\DW4.Ys hzU8 0M6^s4i~{WHsN,ipg9h`'΋{Ƶa 6 n4U)'.,q$P\]\PR\IB׾S/}6+u 7iX\uP ee"XѮi5\7;SC$զ9 ypڭ}87P9o ^/+PI4-M<̄yA#[uRV>vc=J!F<2F$~upIc+ Hk յSaWx&cX7P?*aa,|/z4*)6I[Xs,t b°C9OU9tzuVb,0M'Vyp(+=iEy6V2H7v5ho)=JF#6^M'nw< RDWP8K wNa.r.hȓ\qo%['( [cXUxߠ68{^wEwWvL(o 8@?[l#9eq߬-)עAv[Z2"NLy. ևoeWS% l&ʷ9th]f':P ;I3 z9u^l[0ܥ;35ҽ6sIe% k$` ug`4z5ta,]:Ne2^ǁ;vU1p^@'e qi9de`AWi8NUH\!aKZ\yX1L'5㯙g"L>>ED,A#'|E o[ z+ldt욒 tc==Ùcb2Wފ;q[X"9>ca`{km6׏Y(_r/6m\ERtKyc?c7@g̦ϋ"vJZ x>>h=uƼl1a%2L&B/]vULY&.2 t"H3P;ƊH"&Fw~!0瑕5?  !}B1;sDVHC +1ˉe jwRg.l]C5W1.## mUST.1q{J Ts.nQV~h"hC1Α:D ' aӸ{ xid4?N0,AcK-r8"tMcz.EV`"ByH~|kˇ=, AGk}IBJI3 hhCj3+հ+MiY8PP7Avr*xf9`u7{s<7؜ؐ{LB׻2}隀H .},NP=t[z1qhD0:np0hMn\cq)^c%4<vBYo1$0{ ^uցrޏ]@7z Z׫Pr4|sq|gfqݡ*Q:乎ǂ\dB)YlF3 0n6nE& bqLDO?JÚt <;3ԝIȜvR;/n[V.{dqYqXIW3vr 4 EAӴ8iiL<~* q 몛ӕĜ|Uw4h[95h<GzYN^6yՕ:GjdU[& M_i]ks9vb{mSI 0rgkɦѪCw>%k:(3DnZB:6u͐k:H<3 󹑵Ӌ"ŝVV75 AvvFU/9Gmԫ'3bn9S>$i^epe0yn .DK8|`D\o8mh䤱(pNi2Ar,x+oՠI\Avuq҆=`%#c_1R5h{\Bhp:Y.yc]hFHX6jEf*vC{uk3e xR\&a@F(>fuTA؆0d/sAlkP[G`b(iZcMn9jq7馔A:%X@\pBqV2qοu(yJ9fς,Po ㉘μ(xߨŮ7GGG3VW"HjWWȫ9$ A\cO'=ɘMמ)8'T˩xi㪍.0D.өeY XЮ:V5iw1fk[WRCD,o@7)[+M;pP-%kyX4`a'5WJWƂFID]V\n0yGւg0&ʆtzZNM`w'<WĬ('sD`e`p qh5qˉ٤[AO~ sqttp5u- U|WF&GaaA}V(ADHs35PL2pkrhi6ӳOhtѠezN3a6FbFAM$shIbs(=W!/|"G{Hi؛p5x~}Vj-b>'= St m :R',D7yݤ A.N ,x (Wwi卝k$]x!чwa\${l58;0v"L<3#nLR|t [Th؄W9ކ f >V˭ ; J|r{aMk=B.=IjlstP\(7;HܶDXF# TqѸEX] -e/]c֋$Y 0%8y#`Qk '8lQӽ(ck5Py7~59Bu@sIRfkFX;͠W֘OsYqIDG]4enlT:^Iq LA#dD ' w:2gQJ7BGT+0=~uUtw̍ÿgo6eH+*vc~hns80lЀthrD7`^\b3QB߶&ac/y!:6iyUâ̓ӞY;2CBl1Ҷy5I4F@MxqQ n{dv]@K\n.:'n NRr8Ž-j[0tE"?l\li0X4j CTTUZ4P nȾc u\h0h^kWU;U}²Y7!`FQ"*ѩFs< ]'@btKTp ͐E)2Zc`|-.e]BI.W p=(Rf¹ufv7I#kd;jS %ss3';-n3J7ށyZ:#a}jl/ܻCTy YDF8ݥhiY\_ OuMFұ.e[qesCF9Ge>'D ht-mզ,1f98ü^6\Pl7,h)I4BGtt_MX\R(.6)psN&ٽh1 # 7Li^a98o..*K8@s;(-szb a|DiC$Z:R@)%b46]Dt5M؇bz1>hHOLCSR m$j_+Ľ[kӺ #{f?*&Ö @kw FaB'0QqVO?"*׼(& H\LoF ^9:ד.<fd]ڪkGW ,=t {ʼ88wFj#y4~z~Jb#CQa^ۚ C@ƻO]5[X%lqkn-hI'e,:<!jL>H%u8yIdF uګkUj1,csH$Aoׇ(;tTɸ μ" basնM$-yq#5CwnJ!y!̫uHmg.k{x\#oLh]Uii)"_2ch|cu>K(^Ucca !!mGGl9#MF֜vۂ(&Ge./;62d:K$;*Fi2䯡DE;νgLbZE$xmV3ZZ n; {XƆ,óSy1&LL@s]&@S~"h\GQ֊.QɄt.3vf;K|zʢ NFǐ;M|)yyDps fl`]jW\׵FZԪ,3{..iDP FD#'8e$UPiY9a2.plp7ס (߂'(pATiޯ#i^F*u6|Dy0^KS= +ܥy rLn4t;:kν ҜEzХ ij8hW.MXXL٣Sa"/,|.͞;lbӼҧKKaзMڠk'(7حH@j9"]WJ(DFyuYR9rf9n Raqi-o]Oxy;vwTً11ԣ4%YXMF"aҫ?I^C!`kZEzUDw#ÄcCK88kcri958)ssu!׸Kӊuz[̪iuѬ0 <6FYާ4 ,k_6t ˥ߋJ&QĴn^qW,atD!'D:\u׶Vnx1vFB>7/)uM.&Ykao#Z+`p7ѥ pg5tNf[_! 7MTFdV9͏R PwR-:k ,&"&pHC9_@DdDy/$|esH n:,bC oO7"wJj~MT㌐(xvZZ$H^`!y֩RRnEk{)ZFDI- tG?2 E bk7-@']++qmGnmp 潨(XB ^]<ņAi<5Q÷ \̉,5$m34kɭF76L@{29vic( EUf'Aj| d5i]d'){s toAJMgfW2I|,//>اG)xu串&Jʖ`S9:XZsUpS{4/H?@Z@7ʢ@t:i//M\tNOufX8͐e\Ib+o0a m8zVO1$ ap;2z#byii.`5fB<9#. :@XTU+I6=zD쭋3rZֆ 75ᤴѳ0. 5;SW[ʁ59j4?b$nI~Sq>kVnj=t85wC@YKn.NT9OC< 9l{1S<@PMO(zE9HN ke'lHzU%@OɎlVǫjc N;}S=8ŧb!.qo2cZMA॒s#Krki>6zK]k[蹪$F14%;AU)e[v YI]&/F]=j^jӋIQ"oUXNrhr  2ZA#?(OHeh*aKp)^+bш8(*',T_48܍i-}렺=Cl܂k~nұIk1\5ewk]Ԭsr<nl,;64iǩ"ז5\ D$br6$5:ieºIKO$,6 "5ֆ7]>$@@+9N6#ֈl9@jrlRb1B@[l9I:֝# :v+yQUu*l Ѡk׺dMvH,"ڪlu.$26hرIcX 5:6CqY'DN i%ptFjkqPZfƹ4)w=Fs,J[+6Rw舲L;b8;06zU0813#{Z] |`5 h$/nuۻN$8q _nGEhannzM뾾aaSwaרuZ@X/se`믩1tcdkb4e?*i nU`޵֜MO(#a.z$C򇘇4S`#k@lǭ6e"4Qsq(Y~62HCP5T.g֫kZB9JWHhf8P4Zq+0mz&J8Ze8,&@B:(!^M|ewEUL9~ 3]F?Ek9947W~S1IL wPS%hQiZ-;ң2WP#{b ͒ ӫݕ"Ck3f mL/8%@fQ<#/  i 7pp0;3y'`y76k`jսtpW7q0b90ŭ iiki G] ,Hq^hkKV/e& K&|es 'mڛ-cX滢*R874u^o*Q[w}.slOw֬%M'P uȤ QgWuoI]LwoWPӷ5- ${>s!cK GcŸojwCv 9-$ +β͠7H^縂]j[D${*j)PU3}՟*O arvMGZG&c4rU4rwǵYChH֘#5~|.c{P,MjnNAtv] K񆓞\G~NTF:7kZzGcy&8֝,|ۈz H\T(X^zv,LK+tT)\"K3ݍosӵu=e'bKugUU^="8KkH'b^C]MzA!SYNnU (0̎0ٰyĸf1:.m`WTGL犯^yETTdM*4)'tM ^ޥj f6Iw>F;(en94xc18䕬9GHѰ5%3ߚ#&`IT1MĮ/(P`,4A۫Θ$j"u^&.;lx*Rhy~ZsplhUIJא{ t|$K,=:W)!l@(֗ȯPrJ9?wg==BpKPwx6%#,+/Sɾrb|l8UBYY+A 6Go֥lVwO!L\TQ*ywފ;!%n#W8Dϒ7]eJ-D$~>Du͓)-4<<,Vt~)ewBZPa(]$p u+ԣb` |Bߕ |r$t}JyBfMˈ[M:<@J,w`$zC|1UK~E azG(J67s}KӾt(ϙ)pʡ\ 4GK~\==AQu<6r]j= l@<s#YGGN]lVQal͔j8o[?Ȩ̍7-F3H~!`$1wJ{ MUD]Yauwʣt-t&⹗Cz)B]8B="B["|-V* nGTlT,f VWœxLپgq)7SӦoI} A*V^SxwafTda$=Z+"W]7c@QK rN掖Ğ<>B L;{SL1HAx)VV0tuңz0֞л̚bF먯JV%w:5B3sV8n$9AX%Y a\,1ŏ;1Q@ep{ O<*,x|qfXe kǨ(:'؛\4|M׉*Z .\h6i óy 4X4e{ZJl{K%M̅s%2KuԀe -R9ڵ8,tETa R2ߡRqu$'f#!vQ+*@ +lztBxEj:^S75-WzҠj)Q;4 f[ׯ& }]HuKթ/5&fqӁp+Zap9BMu%d igCuJta 4pғRl+.X&D֊;SQZ l o\6ޡG45]ok,+^b;+TC礬HY-AЋUȺT,ѬP*`k7TCQi4n+'L\8h. mks^к]{8ib_4L7 a'n+̙]hX4lj6خHͶq}|:-l!dftŁɎhKKE5\-Z+e$ _1}"Ϊ6+p9(BJi rh&$$rտ*W aZeAFZ?eU0j,v@T$M)tu^K> h,K {hӅۧeHjWm^[UCmMn Uq#O^p1oo\kx;E#op8U.5+ `+Ȯ] {.AB ;:8kع*p:PztH8}j;vwZwuRYGڦ[ 肕֤WwȬ} 8uhsa"UoRiszC:좕G(C^d8V'kmv6U"7O̙#-e1=I >Ħ9n6@!p Q6+e\H tOv1m J0ଲRwкLВ@#@ pNg^t׻m}khmlxħcKPz1MHmҍZO#qXP@M+\>hpЖ*n]nv<M4Ddr~g*a5PsC;/r6m43it]t,ki׎rOATG-רX,v%t:V<˔ۣP!B좯].Qذ6ըPiߪnhyLjn 1h#kBΖuytuΐ6]6 P;_s_ٲpwsK=!B;^ÊDvs]閩#[i`a M^ckMqm)kz8s`jP CO@N˔v֎mD+0.qP3Hjk;[Zz;~g#(@~M|PnG]kεxlTofm2x%3 Z=j&7mL_2t7|U^nCOD/ST)iKObs9ĎeP yy-]wWm%7(^NV4#DTJ9w)WyCܻ٣ȡU(w~osvBTrobkIid64Ta ]MJ]]P\"w8cFUe 4ץڡu $wKIfS]kk~ԛdƔ!A`]IF}ԨC'k@;Q|5Lh zOjpiWڲ42 A4w,)ZC}(y` $Bjۚ8Sj6ҫ '1O?Tx4}Jh9Z+Ku1äMݩ9m NIn c(i4,ޛv6zWW C{ם9ۊޔ(7a5|] K(]-%o_fDu,g~Pͽ ˦Qc@N#^ܹMn*EBtA]t .u7TN twP@뭔l٪gZzA{yV‡]Ԋ K94ړ:!Ƈ4#ΓI']Ggpe8 Z: 1 b}{8C uٿp'ҝK>*5kGB t4u'ZB ]i.ڬklރ5\4 ncg_iܺ,Ӌu _BNn{6KnP8BUN.ݚQ)sNtpSu8Nj;h Mv(A @@ȥw%%]m,@X]ӫbT ] Mhni~ЕYBu`$ނ$l(q\lMP IElƚ+Ը(k ?]4Гѥ;0~=IJ줲4x]=V;RlHV OYdA\ޔ/}-Q6RUD:z{P/( VAi^:l{N0{5*NTnqۧ^Pܝ|}Ku^xiB v8]Ej:BjA:_Zoc;+e 4Lq&lTGEI2BuR>S~VKJ_(B=jj(dwZVV@p8үQ'lȿ1zQ˕kWR'B Sn`Eχ=jSm$15_rsHiciO7BnHAI_yII=uF$yaUD:R1th^ 'mZ8+#owwQkI4[cD([>)w 4q/WD<ŧHրzuyi!O6yǵDKn :]ys^Ӧ%/]1diY|ToF6بCmh;Ս+KQc6:46ga(2+Q|eiU|?g!\s2tgZܮ "/; 1&:&t̡C։/Gdﳂ tn[Bk@|֜'YĴgcGD(mPr?+Q>b Xu$eѮLܔ}1Pxiعw[n>p7Dt=]BM4uP8%y!n֓@<&ޡvmqێRw(C8|h- 4Hoޜwbs „8ǒ3lm<+*(]w6 K&=ޥ"k.l\4H+>u-w)uK&GPt]6\khMI.;aT(pq״\\ endstream endobj 83 0 obj <>stream 8 8 8 8 endstream endobj 84 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD4>"  {!1A"2QaqB#$R3brCS %&'()*456789:DEFGHIJTUVWXYZcdefghijstuvwxyz~!1AQa"2q #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?,ӥH:,N:c :,$賦 :,M!b.'A&1:,M&1;b&1:t$\N1LEN$ tЀӧLcN1$&:tӧLcE1v&4 1aND$H0jfn)pn*崏9od[nYl H9{SWXTо,W:X(d{V$bX-=]g*GHڎ)cś_L2")Ͽ<^Um_ U.ewS^ŋk1,k%Bм]onJ5*5WL2efAU=&g7u]2.Fb@"֖.&J2mIQOt+PCPC 9">ZۍGol-nhp{uҌӵe2&z#}܄p$ _ࡡ]Qݢ32*\[M@`^_' ҂ʓ}R/Irp]OHiq8=ʾ"%[ ICwX)*^1jd2qF5(\b]P0$|Ch=nmۓGfr"y]'2)t05~pH[Y:)S q-iBInr`c?OV%t K?R?IOPǬ+pl-a3Gjq-'n϶uhi%h?&óP)btQ(ݭ @aو-w-!ͺ^/N{5Lym[)>P;Jq1Β Yq"wYHMM ! l&& 2h:,bE2R.Mn#t(о&ʪO2ejɸz;Ff%kT3L 6tR:P-賥:,$賦1ӧNbt賧@cE1:ttIbLcN1:ttЀIgB'N1:t:tIgBa"Ν1ttӧLcN1΋ :,C1bd,MM#c縲kzBg{UbZfoDPth))n*4%j .TrsNf=EkMsSb;-tbKh[@<ʻa&n5O!6ŷ(;a'چ9neO 9^n}$h4.g4WQp8ӟ-4g@m25_'jfQ:ΰ*6ʟR5 S|UjKN %ɠw7ƒ̱hܵ*k@ToRBdhg´\qTeo2jWB`a*!NAjl['洈dZ|y &34^wDdO(A!euz W1([ty_t6M0dj!FAqUs4iy1Zp+mS#M iSJ#e_h_f!x%6ITN& ;j)4x/2%*՟]E96g֔8z W~n܌P65tL{fZ>SW s'OH*IGqq5]2SȘaz1DzmS:N2kƺ . :\}#%Z!0\۷&)\|R&4ZgTpA0[5#M1v9Lk!!2ۇگ1j Bz6Kr2ߍڅ0--d~ n T*pf5g@p֏ᨧVn~QRk_ Mai8TDWpIiۤ4kt-K#hƤ 1UI7)3 ~Bml=M'Uꜣvkc7+d9G!Fcl-BTgkDE_S'⬊U`dUW53+VPRފdt[E n?d!m$e?/ǔrCgN&0EIL$$:tR61&1ӧE&0NN:c :,$賦0"t tXӧLa'E$:tИӧLcE}yv tE1:tGZEɈҺQ!"ڵ ,{% Bhݫ)rpPN70Pi~kE[*T뱬ېv.j)5x}>Ζd7iEYVlg\iwsئeU.ORan,zԼrWx"`|+DnRP-4/s\::)3\Z͍h||LZ܃Fg|a6 :LHyHѹUS EȆ.k. }c!G{t#G֑|!rHGaB&kHImHZJ}iix"pAev71ѪUQ" PET'_M(iiMlCZZjh½#ɔ138#[lAN=CQs6RDQQ 5|(6Q5,4ЯqM OxV8usQYr5W[FՌvV+?H+ZI63WIY'-_|,cYZ9Q3LN &D?0dxmimrZUC jVáϱZpttF}wqTPCեjjvZ AfA'ytZ=65$Ϸ s[ km56v%_Z@stq&M3qf+֯M9J'7YRzz&-kGB9]5;rTm SNf3P0ɍ2k5J lH<ՃvD&7Vn^EӨU5 "B&|6%2nD 7rm7(\B{چ=A$'il3:ӈT[m~EBAinx(ap_Q<"Z<}3\Zɽ2VRXK!v{&*qX +gqB.y:wN;oq-kNE@}a'(6Y_m̿S Y1ss<:t&:q8S:p11")1$T$/# N&0#( $LΌca Sf@b#ȉiZ!к&[au:}Cc Vt"ͤL&ڽLڃLankr#ME\w0sr12iBdv)lbW/ნd͓ Qf3Zy hfAohpfi97o'>0$s* )b4.܀cm!6Ib`eoYgܳЪ9i3p:ʕK"%PRĆkY7neVvAVW9S@OkB*c8yjҡDU186 bI31DxcNDkم`;j@ Ą.LItsJZ90 I#0lF:vP>FgQN)ADyb&+VZN18 R"dǬ f38b#PqYSw2NO#;KAǵBvJ`.Tb1i `Hqz iew.S(y_fSiAV?=0u15,G;LC|h ]c83;kij PJN3|.Ț) 1G`p+!vaiji"T'1/(A'QBOYS"\ )"jo=27}p|#hΣ$nϧQb#z6sOVW=q!4 U6kpjV:#^5sVd|Tm#{KTog'v:85giC'D}J:6S9G,@qd߇L#=LP%5ERNY'N>Y_VI8'h0H:{O&,pL|k vǼӻب3M:iфJzj2*ی85v eͱ1b9oͮyZ[fi&eQB]( _*?Y+b= HT(0="nDm%OH0f'ZSx-X2EóEړ/nN>XV@{{IT^Q'g,\R<|+haZ%_V`zEzA7*: &E Y ᾌͱPcgs5z5@2 "9ec\i- 'և4p{^I{TRdDƲ۲`к|3 njX)jFx eTNA 1+ %rdE&ʠmµ-IWѷ Ѹj{&pk_iiH-AuU2i13`*c#HoLgPY`VoTҙ4QF.N UvM2 }XQJV:AkZX,y!N@%FiEcLs&1)V8tHE,Ouc}8SNÜQc(p4f ,MG## gudH+48RpIZ]+e}ZUn}%1MFbLhKٗo_6% '8X8PՑ;1 >!0r'596'nN͙ Ko$y vɍ5T9fp1ݥ?)ڐ"'wO#4)l\Lh#""!@‚G 󸁘0s0]∰nHh4ǎY1oǤ +HdD\Cr'`D ;hp\Ѯ&l:á)4:fV"hqTE>2LQ97;&` NQ|FnqR5rXPj}SaYSと@oZtћrq*9PFkֺx ml>k𚧼=̷- XZu7-kEOg sJ3[`gqjnu $EjQ8IM!sp+T8m.nh@xUe&U8=Ֆ KfrewYWQvq*韭1jSSS0mANH*s?ZDxM'韭3׎(ƣ$_H/k]/.p>IV!~Lhnwy24Z!NpuS29!Jhe# 7A5LgA*9S)6ʞsexŝF8 y jNP[;_ ~dC}`ɤH3wSXfJ6'{meiS͟9&Mw+tKA1uIéLM֧g|̸ ]هzٚṜX(ga"<`A4ne4 F7󚣃 tāMP`xu2̅.5 TTkG"U2>-+:7O4#KoTW8ǧVL;4#^h^:$fb1LP̘d UaqY|vgY2Yc`tŴ7 +"GrpV*ۄ6 9I isg9g;Z܈]@0'4k.؍ TO֔MZs^\V`HjCiZ]EfZf:󘗜V>l44Y׆m>q,*RҲ#^k8k屔%ImRԒ7qa}`7xiTa՝F>*bf t_evUmˆJ.A1 9_9Fsי`^@bEQTg`tיw95:Sfk嗮i}ѹɈ͘`Yb1!9՝Lc'1D$nhFW X4!\QCp<:L YTYݜpRGFHI"^wE+~s@[hZ^v\Kjc.fi+|EP&e~Ѽ$SI "񽢍Ho,U9I;I'w9Ff1(KmKc54QP g` QRi4!16pqX0ɠӹQ^*k25kZT"f0PHE؏˜4G Ɏ="e]tHh!-3k###U(*f 2e`Q;Jn5 Z~'W[FUZW :Mg Tnhҷ@1&&zFVNP#u;F"\^\Қ;Z5;:!!#M&`qX)`_ Cg&H/-k`|pM̈́ Trc;^Lf+Xf?HFz&W#/'3C i֚4C kq d<X-!zldbNEyz> =#9zHzmh-(p ۃ GI)u~׎<6ך^nr9fSm^ibA To}y}hր=Bt[3kp֬lŠVMգ$֚AU&pwIq[$B`/V#oiUNj,r7-I牟GCeFN1~EèPLU@ڇA z>.z5Pw>ĝmqyJ;2JUN>S)֣W5ƠF6/xTlF{iR,P@H jXXDZTH&Y":#ӑSlf `&6-|LJ cILF#{`fdG1G9#R#01Qrb*5)$(92TcDu:y9H녞}) h&M7NÅD7ѮPF9"`ܜ}I ] BcJTR0:g^@hRH/8F8!C(2b4&y _܃!d) ͌~v>,t^W9oP$flZֵTUKz:̢s%G1{{vc-v)6 mZYNj=oD4Y)v$bs2LiF2 7"wxNg0OXLMqk5^=LZa7zBrmJu.ٕhmV387qՄB(ß*+A.O3E@t^ hQ"db׵qTgi%TiSc)WѢw:vv;'{Q+4TctgwؑR2ϙ*#c<}gP793K 90D+Q43a&0"c 7$$ȘQiS:ש`0 0"G*`e30cܤ I(R 5 bL)JIFS(UX9pzqiIp"* XHosPpeA]&h' F$~:yMycTPnC5Xsdj{*WJlb2L ,@] 鉦XLAW9H&i!HPMtE;S &&i#q£E'h "7wإNzyR{KJ fhŦG'B"(b6uASF=u;{&ö$ۂ!Z!id)6T ColiGiAccmO'1kLfUzxqjuBrs/n'2>Q.GŚ*%x>4xmQ܏v<:0Xo&(c{nm+w{mfIhH4ܲ7V yA#n7"@,]@hQ?u38>hשhTwHOS) ڞtG'`z{"ii#PưΣw8s\F1giaIhB89㑝3C Z SxUxj .7 c e՝Ȫ>OZCP}CڷFvT{G9l"ӷv<8e+T wRX4 M*vcN 哈ADָifr;˩`U[`2b5'UMNnO͜mhUJUKĬl:%{K|H-Ɏ#3c)sOɶbf]=X#-v1ԍUSlelmo FIV)@2r#M \G="A@&0Dx<0rfFs";LasfGRL(,eP'Pgc90b2sfp%Tfm1w7(l#)$rN漡rkEiQ :tŝ:,?9=$j1q,xN*W}hK2N@@~aCD!8]9'\\5 /IPqpⷃ)gI<>hA(7G;x:MaLi&h@Z~pekSLoaaIxje_HT&`t|js>vc LҰXP[A\5t*p J:M\̋A`PJ*pb)=2wRaIz0,l8#=t`6لa}vzγq(ڤNڠh&6Hͫej dF793`q$\ΧO2B6^s lvlƖ-W&38neF%QB`F-nyI6fUvSiR>Zpo?(+H ~ GnEGֆXunVn1M$i@u0Y:,HPbEɭu>!7|S9xN㔳۞8cRj;5{C#8\܏c8 enGň8e°%NB %syLZ}3x9 BU6G1ڨ ,WxULCENm/@sHD`G'd|SA摣Z})i{"vs]4 >⏩. 8Sbh jlA)Z?=ԣc4FT j<,EjR[`<6Ǿ×1ZL{&~>]U~>۾ ƣ#X|c43JgQyUCq1Ƴ5C6MۣD2-xmgIn X@rWs yRq1m]-JlS9O8$ida!IX4m6%Zm#w`>kLRĘ`}DM4Ĥ@%FՖ2}G'sSmibXĔqꌨ2L!ݕXnƒT}C'h]iTv a_aeJNb8'~qؽ;TTN;[NK8*BÜr>v09ڳ.aɍ앎 %=$mI@b%Dg*9`$0$d 2$d XY(w1 HɃgr8LJo-P!FU".D܂2cCkY"ZbāNDž3Ѿ3Bb$ۆX%k/ۇט֕7!X6Bbw^9CcgS RAfْl[ӑ7&rݎNc AZ.6t{*pSo^nמZH^a7L`b~fCX}"\}5W15`oU|A/_*p%QQj39cNA#)ƃLSA|!si N& ?$GuwmeAo5נ4hcÏ&,l[y#ؙŽа[bvyp*y٦h;#;0фa5z ٙ r<t1t4/܏eqCpEڑ'%[F.NjPFHVYT)HT|c$[+[Vu?$Q@Bͭ,"u98gBD9>t踔$t ӱ1b~7yfϋ֮،?(K>o5UBgDi (( !{6 O?!  U_x cΚ̾?$u:-eO Ix\5׎IfMzGE#4vH|!0;3;MZw<1NI$"!thfML}iޯQΖ3fhf6wpES}h7  9~Xj8%[Ngw >v2VH&Bޏ浏ԚZ [۠@yn9FEaܰ~r3\|iSݥV8q͌5'Cj+pT^5w3$zva4Ӥ¥*vKI.x[ۉ/a*1b4#HQ"vQ8@ I{Tֆ@DiKBiPmp=L+\WאiUVٗ8;q#!W} w`LM(0jҼNscƆ8rjJ#c* f!#h@-}`Ȁ3.+%eҽZLmSu2EH` hY!7ԣ.Lat&zŧQ);ir؏S#pw=ewU%r*IvY CUw3; 88ncL~!2\ gɓO8V܁n% b"axk:z֙?C(- #*ֳF`8_(b*Ֆd'fo%iX"YZ<3;U_ F9Dg=!KmK2+/ۄFV_ ]1^g#|})e6(<%O C1E.:֥8qx30?N%NTF ҍ0E-1nueZ&3Ƥ0MᬾbgԲAA_5*(ܑ#[bvL:[™>R#O߶`P3f8JؘMfamVcfi3;kɏ/.2Y~23kTsF Ѓ,j Ւ+z>7y`SD4[OieoWǎ;|:NȎ4]Fh7Sy"EwW?^d~Ȣ饛#JQ>C㇤:_y&w5%ZQZL[D+p=TMEƬHDCl 5`7sq=Ɂ  sR-V̒(J:tHLpƦ$^T'r3K1Rҹ<ڃt ӷ^șh񼳺aAP0wRq+OH Tq}HwAI(3@h1N3;11U "fj^Xl!nN>X0 _3 fFN mp99.nj?Qv9T1E~54g0< 0ߏES}iji4DՕ&wD}? x CMSkQ]E|92l4 Ra2#z;q>=!bsCB\nd 1W\ v́8#yoq;lR2F9<ّm58i*sw%5j4F7$ubD@//\?uU)Ү#0"iMtHaF@'NyCA$/iQ5 B"H;"5%W,95Vc5Jx^p98`Oxu1CT <5x{ra@Z^rs MMaqvL6aƞ ly8}1È^UԚ:,{Ư-Ot}i>AZQ/ SQp t|Y8[ȎB;zϠj˳E(@Ӣ֜0*ҥ>l ШA02é[Ժw^~iETw~ ʽh4(FI?,54?\c`>Qx%Q11^y5 w;׍<|O#!h֎"><*J="4FU2}?R4ۡˣ&1&hz߃z1ԬnLO8*i&ȭi\9ЁǏڞtd$ QM<5m8SwJ,GTGIH/P`t4{'H*ӌ `XmJMyC4ȴҢMY X2~ٟ91dƙjDB D*Ao<1bd`Ɛ``q8Iy3U'#L:n6|YOKt($lb! 30 tt\AS0P1[7` Es\r,y#LxQ /S;PɈ7:,L2$X9TrdQ ɨ-u$i UwokfGezS*i 6{ `sk@(14$LpG~snICo}C?Z.~j4A(!Kr>֍64>҃y3TVXajbcWQGlӬ<"xk/!nN¢dv㟖']N~Xf"ΖZխXpL~#>r EҘe@ڸ*8#~[ {ĩ}ŮܕS弅xЋ,hZKYvF t6p<ą}!$*DמF55TH~Q-/dD^5h<*}?R!Cٚ$@S8+7a '$O,$א.hVmjaG\= <|k^S~cMg%L.xY~ nxo ]zIs¾ÇD}HamCMySh%e7$CoPG 1U<q hV=`nS ,إTn J T;u/pNwe3˵.Jͮ.A4&vN@m"~%gRNe| p)z㨂Xk%Չ+ :} o&h*py|Xmh~zADO4F65G1Ҩl=m>_,4u47/tC7GǚC/~2f|'O<}hϗfCt4$ y֜kS~zKς& G LqPFC&br)&!L.cI;5u ݟG&&A9Ul.ӂIZ[lA |CMHpӻrRl5Hs?KyF>SAf󋩱x(@$nY7[N|Ę&88+c"<'S |2q1>zFlI93&0[$,S,#jBAwf!$V&S"hdfo%`H1[tJBNbS 8M:*3HH>ELlA,(7RN%`Ɣog _|DxbN0~8B.L(G׌~viCd }ꏯ8%1cC8h35ODo7Ԛ3u8b 3B :|.s~Ѝ,*VNJX6#3l@#AeuXjl̢Ŷ^ero[uMRgUg$&JڛR8$LJt+*FSvgciRFUǤSkJw37(ZE9FTpNRI$XŸjN>)>OzOWpMycD8iN?R@ vq;8S]D"ף4N|C߁)} F2(< :0 CC0duWbC#~U)vq#8VNiiDO+ ;i"lr.:C$^/vP] 憽Ju1$J!饍G;#h4ڼ^բiׄON.6 'vwhS4N,5,L 'eb6q>,99>}SF|;Lbj$葳wGd:ugp$2\`H&8 p$v81dND1KLm0V'9qDq&6dERb7.)w3A"1؀i&IpREXdTڣQL,OYdJ6ƝYq}~uHk ƃլ&u10rx, lƾ2Żo)`UlS#6]1U]s-8ĶnEUw7e;/ZTF|y{&Ւ3l>9s8q)mhMY2-bJOG)S4Lije9<j8F,Ԩ dk>)ԤkSME&R5x*)8љGnXQWxx|g>0׫J gCuZeƯ9j3^Rb2f 5mxdW#]4Fy7icCt׵#y}#XX:Sl \t׵ RrF($5`Zj#IX *DѶ=漡l僩$DWGN ) _zsP_z"B7 +jSH SX 'g;:M`'o'!-kZ5DLg 9feNc9c`V߸dU-* )]FF|s8;1E3&10u }k׬KHb26Q_qHZzF#v9Yh7oMA~MC/VhYTwxAﻃَv8VxcSub ŷ]dIѦ΂[NTiP]Br *6GY5#l0)mhl9Rv &g5" L޸ ¡l{ycss;MiC$k]~wz]fڍf|Ouq;xcM,6}~a5z2Ln1Í]MM&fu;ꎇiٓG֎ގ{4љX3.8 'z_{ 9?M( =dŤjWhy|){y!gaǙI)7ヲI晩/֪k_eRs"l֙M yLG>" y>w6edcUwZQ}ҍ@3vKog >OP!:'*#p$'P>G9GsJ4r7EQ}ofT|w44f=Um&55jg|*Ѭ٩15rb=GHR4C>QqXcfџhwmCmZX7U?,Qyq#<&̮q8M)mZY?F~Y|s7[Z|mp&ڴ3v a~ kY]fറx%3M6 ŮǯSAMA6{68Ezk׾)x+V5}PMn#y #2@:=#YKXy3vcߌV*q,\ fuZU>枎}OK6{Te39cfTCG L͙ -88.n<ၻLہϜTlPrq xd ]~YLqKx1^~S)0PTMuYck񾩉;25P*5 K ^yX ]Y0&]Av4W]|9ty\Cu4Q,ϭr.j0&B_ * yTR>j(L 2؂$-m~,\|Aӈͯ_>_=$|u1 WkcW>_x/AbMktGQGca7#~`5^z>E~~|Da /S~*q\Mt׵cZg Z}OЋ5_3i ~_r{J{c T4YzB'~Q|68Hp$eQZ3xF/jA/ԓRH `B=Mj5p2,"GM+zI\)ض'HZn県׮99aj--?R5ڢBb9na`sM@.5x)lAY*1sqPwܘj- t%k`L$0 P,V8"Y^%z5\&;vv( >kNN32o1iqKj(m^Ӵ;$AIJTլsms][6OJZg{fY[]z(1(I#5w1 Wp?YݒW<2B+;XkiЇa[1.$Jś:Lc!8RyNMAog;[yD5hC8*)Ʃ&B1 3;D5}I 'vI b*M&4MAThB;XLhVqXb5V`|+0f10Ep)7Ǿq"4M %$f-=7Oz`ܷ-_c#lQ1;]֌flZpj=<'\_ZSP2+V5T({%jvUʞ~P c a㖺׍u~Qhvzr@SB&^9dI&&+zNTJޯiԨk2FM 04H<*~IJ5>Nx ?Cx)ѩO }w`Mx'T򖚛a'p(z F62Z4۳;J+GԊV15\`!#!D=[y<S^5 2ӑP(X qx MxiB}<(l1x"kƸZkr"0߄GꏭpyQ XL.zQ-*m;Reau\.\fSc,O232, eJ4LyL˪6ļ.T|IᏀKu?,ru$VvJ~QL c}Hۅ~Ɇ |n^ֱM3:ņ3ei I)Ä2>^E fei1]cY@Yz6*@( 3[`}+}N= t2id;bFyƚ+ E9I{h 8 u{fgx$=/lD(QGNX Ll($)  Fuh1;&P.NbFyt4aلDqN(`.PIFF󀋤s1 D A1 F#13Fq"c|7].31v>1P$CsLil6 "X FvM1Q$Eϔ7KI)PzI3AsQR1 T+bYRvO2`{ğ"=DIKؒ3GdܑQAcXN pV&?'I&c; m #2j n#A!I![s0LPQmc2 ,;@78Uo;V62$#v-vU`#Й\" 9&XC\ Cj6ߜCl7.z7.G53ySzK^rwc }Z:N|L5m+LRQO m*#-TU0ARrkPpYl=ie09Pw՜|StU}C~Hh)Ah=sԶTP̨u+wԧ۴`=ӏt0R y˽cbv tB K ;enwO`b_<@)ǺN( Ro>F!w+P JDeM$˼6'y^ VeV82 (vneӱ"Dn#Yc4@T}Co~=P&{~jQvkS ϰ\f /eCTݒ9zQа)qR˾I*z9}uWb.+.2tL=cꡧҫ+p+\ZJ[BaWP]UTu.tVL%Wb7el6k=F,Oӌ?KDPmvq[qV#88[v #rqr|ἧi84Dyƒq[5b1;iw0^s!._+lvЁ,췜O;yu>9ƇrbƂ|^jyٝvf$i;[F|ʼnh4j3M5MF,&+8DGN 'cEj)1s3x!D~ruŐ156;ggv`EVj$Uec0u9]؅xWl֏\xn9\W\N5iPa \_Ti=$Ӭae(;69Enq:B!ˎMJ9HA0f EC)vƘ 2.ttdΓPP[r &[FKF7< K1% ]ȸ87H^ٲyR}f!G~zs1i.HìxswX/jF|w}|w) dm"T'^8h>Ox?|w37듼ui>sP|w2Ͱ opPk{R4VS'f_=JX; S5fvj'=wTKJV`[ӐEӧjPde)e.3eTLSF }͗3 \a4?6G'6_@>H4u4HV?@>H ؟>H(hzA+@SŇ/@>H+J/a#xAm&vIh ⏒)?ABc41B#G ޓ;I^Zoyw4Q> Țgih P#{;A=b}MH1A@s2{A;[V>[$ZR'JخbU[Wywj@ORrIƠ?ũ. F)jmQzsjTšTp 'EC[wZo2EИɴO_]\ .( '9F9#M[9sk.F%-X ])F1 xwlӻfȝ4٧vHݧvFqM q|6#odth`lCS^؈Į"/:I HyH" yNdij)ݪFFLi$< M~|p'`MPHk<`F홍$&cHLLD.!!0;c1[f0m'a'{2 h[,F!#$o31fop>kTaq , cԸeV¾1-<aF.LQgr~)~Nz'Hi [;cZˣw?R ƺFLF2?R!OԚE1er:Ls[}@_^5רVκ IVM tgV!Vn k $*{&eǔ7[ٍ 9^85u]d |\sa&F?fӅ\&㖿B>IÎZ>Id=_9HZ>?$Ib\xb_grG8_$׃u1VޫWfö@>H[}&kQRι#dk[Hf@>IÏ[}& +ko?$a5vk2R#A vЏwԾ|^9.ҳJ̄|G$Ci&⍆ϩIosOC*;5aR= MNl3#b׍2w*n⯜´;f@ AP.Z9 iZ$l?9%:hgpS|J|+IOh<q\CIh4ŪGKM 1 v`HM/8`Da8K82H&)y/9;HYI^s鉉iyODD\M,$O&DBM4OB14PJUldFxFОs/,]3T?BҾq/M!MPPyv&.;G&"bi5Ơ{gi;v#pg` 6Fӏ)q(oF#ifs 1-.QyD f#{X".Fw1uQi L1Fpp5"Tkm45a025W<̒fv;ga)f-Ӎn78yČ!"CDV!0ȣP U ` bi .RnnX`!E$4n4oQ8=j|h>SL\3.0Lv4p 2Yp"m4jpc*(f &5 '_CjZ{XbmtA8 <fQ =O;'k9LJ5di kG.o5U#sQ*Qu3&hZRD=&kUh-kblխLk!UuuGī75OӖ)U92U:hR멛2(/xE[\v*MM$-E`DZ4ըLN8ChghZ!E{&\^i4!{&4Nv4ɧvmڼB8iݓN;5_2Gvmiݫ^i4#74;x&M :3`;AofӴ4v44 hi4-'hhЌ#Gi-'iih&M4]m8M&b` ӻF&i4!0g`5Ў 8hF5"c DNc0lhq3ȘĔsSJc)=ܙE!ْNpef?ⵯj[`'q[Z=eՆJw8Μ#q1Ug`(c1qHb``1&ƕcd(@;Ky@5N&bCdT#VmN|qs5.}dg|Mk5NSLș<"=17,1Zh9K&?`#o`0N}CkB6c2ED9M+A= O_2{9m8ϾkyhFHI93^3YY-F =3(c䙕("AJ]iZx|x#|Q{R5x5@ Ǡo((2=Wq {f8U p}'|?G 2b^Ԃ /? MMwYRGHNĠxEm%unH"~3a>QNn6&'f|vgkgJ֝x֘L *&5^ԍc#>W=>(o(yMt7:}AH<,& #tƆ|FH[mA) .sgivj*m "6~ 0QrÔE4Rқ]&zfV@zP-NXC1D?ˌy.< '($\KQP;L `F؍&OR*1b9vrF I/kOwiK@d@c&)D5)J2bu=thdQ3&/O&~SJ429Mtk4C 2]t]Thd9U/(yM(L]?(yM@CN%CޒehcFD`~~SP#X~~S'҃ q$yNOA fgf?)) CَԞSPJ417RyDԞPΊYgjX$6tvV&DƁ#xccy3;z#L0wl*ް@CY,؅_Y09e~+čW4P~'䞁®L& *W7q]Xi{$$:p7931ڈ1Q4Lab8~/oE2+,%# k.L_V?cƭ$O}3=m#I[;?$r8^S^5רW vS8usRea5]z5l.GxĦ)&F F9KaBmq +S`]H!~A)^jwJ) |AAUT5H&Abfqզt7 eTg;gP;h?$U$C!fh0cp˶]:/HG<_eMwZ(S7Ow]'s@jFk 7bGX=fT^āwb|idX$ؙY;H&'d|jxNLЁR,Nė>s#4#T0?dzF.L d{{"c 67ifka#WSLƊGcTMmbv~٨jgh ̗G7Dƨ ؎ǶcTf"b;18W=g0`v3Yk@;$ۂt`S!V=Zb 杅ƗL%J54yJ8j3# X;T0E<"dUt2,ۉnR3ItE/;@LvMkwOoӉce%́%a6tFa)+G|r&cc{&fUÀV!jLFS][p E":˾38'6r-4Ţ5RH7w)93#^Eј0e *괅j=ÆJIԵfZ`A`өJj6ē5!JDp#k `}#Vv% e 5m6w9 ; ;Qt( 7aXpg3;SakeyMtׄ8>S|k5>y3;Kg\7 SyĿEyM2f4y7iV3@$%ƾC`uMA8hh`&O]ihh !ϜA8 V '` 4Dv 3q14$v&H1w &'Qq%l"}ft SAֶsP"37*GEÕ_@v#Ϝĭ-A&!WPo9Yh71avH ߗ)ݒm9YR7~7D<)LNʘO40inHS+Fx#BcUi7@dfݷ4NѮS |&{_Ct[L~/N( ɇn>xI5"ky@ԅ855!'.ɱ8a5_ԍ㐉x*awMt7g=p|(]O1B5^z#.|a^fQ8=Mt7{˿1#=wes5k̺xџ5|~9Lt[-_<^!Li◧|W<2kי~Pg.uyy3y:pD0,ZdP,JgW=AĬjӏ }&܀:F$3%SRK tuab>E=V"(9εr7Q?0=֮6ipFLjQv'='v+G MP7lSem:hfK/CY|{F$DGcfG9ݨ1&iڏ(i)ݰm$lQpLC #LvaIf&gfh4XyEoY.I:tbdŎU.t3FTd7hXP""%ڮ͌2/n9rmpYJ¼ {N$ qc2TPMcO8L9 3A*'9H+"(d-*@8Ć1$ v0/y;ic6kY/dMsV'J؅.1n>oa*[I)S[j˔DDADLD΋dž28L9+e|PVVz82D8LB/Yk!LѿR@TbeZ3v˟8Q* DnTCo3mmׁrыNҹT7=o(xWiƽKџf& W]12ͳt.aO nJp3~ 35@՝,("s]\\~Xupyfγv튩VE='e356$Z5`Ɔ+vK)ߜmNm50T*lm˪0ĕD+:@ice (9J|$5"ڇ1/\0,Bw49+L媔Z9hvYr9ԕIE'*Ńt&袚(>45yo4B&WwbE"4$!q19/ds5;`JGX$.[4>|SE1(R V1 pS*lԪvcLfO.,9Kv zۍlm <ݨ9fGPuhScd:l|1CfvsE1LFoTQo)9al]\%,Q8B5,+0veQSdOZ>,sӡDlS$PPc^NĚTC#2{#MdIU+#lN6*+ %lOѿYB"9yJ #ĭ6u[ѭ̩-k$ilnqI{M -%|&sY\Q+ 3ԩe,$/) 5(&`J) T9;b'eH/2Hdb`8(:8yJ̃3k{^\:2QFc(6i7 ?8m L,C+Y3g'#,`ZZq8=P!KLX2# f%rGX";4]7읠y]xD|E5ZjlV27s۸ZT<) ]SP^߹S\%rP%$8XbYC vgV<s71H cy _u)Vd98u*S4#cg6ʧOajc>q4PcpmDbuJ#5Ctx}c&F[vzs4Ʋ08NjM( =#0-$I#024-ڟ(yM(ѬnwjSVQX¬NL-7ռFZ&whSIXLiF5ƚ4g$(rf#Te8$N;FSH&]SI 1MAtLMM;&i4!tLLL2h7L r`@X9edPTookv!.^]|-Zn)Uͧl4N46 bEOw  :Y/X0`N;T|FE%m#N@rdPpKA:8V x\ ![JŌANv#qj >bdQv`4Vf_5-+I N$118 Ec 4O# 2E;Q(d:_ uRHΙ ķl.|ҡEc$oO|YPD ً6ODCc@OEaTG# yܜb4Lg=fҴR:AN'hۙ5Fq#<|seT@We0 ڑdx56W`UUViDY+ A>4+OS5̴xOZgp] Hq ] yYG|bȃxsc4]xx珖/p,7Dc}jc6h-~:/'i3@V##5j3mF4ar"S>Q5cIo9֐mkfJ0!DV$ Vւخ)>_i55nLSGRT!:CijV Q e=`Kun{*qfI=.۬Ju;ψLF8@@:FbUV-h d@8o(t #8;KyE Aa،r~uH1lNdkMb/-J n<d fN)e))A  L$(:y@':\4ey1.qP,r$u -b>8 RWӕ=rs dbRbbvLBbcF"fq3\`ňv51O,#7 yI4Ӧ0LdQɏ켌*TdDsm2G9dgjs6/Ct`L8sjQ&\&N"ZU)e3U+Qj<7%oAE61)`̝iW$w1{6?H@( 'jsc߶ P?~0* T`Fry-tN;6 rC ![*T ePN9Mu7Lt}Sn d"W \jҪ Zmjeܥ@g.}^{[jA78LKM嘬uGai.v75 n4S@p e1q68uy;eeD>o/i@ ]SclWGVm GχAz_Ayi2O@!xLiay6 v 򈽽MyصO$1¯]Sğ(5ZviF|n0AM[j9q,O<1+[SuĕMVu&G8A!iUT G-Tk^(w*bX2AkeA0˗*TWɱ.;GU]! Djʸ4$ǃHq—kûodCX?(aH1 b"S#4Fhٙ0iݫGvG1{#4Fi'dzDk5NѤN3[ŚH))ݗh0;SI{#>SAI̛aE &IL>Rŭ*# 0czҩ]v%VRc&Ȼڌ1=ƣc/[F~azj,Ϥ3>+cmcH*ngY lfj-4 ~im3L i ē 8 USΡkV]D#xiQ`l݂{dpu LX lIvKp:DxzȯͳSmקI]b2#Ov2lmJ(RʷIƸP"s jJ8ĩZ˨yX&ͲRPyJI7\mI")CDbLLiR#P%U8OKzbAuIVU\o*b_XGELD+bv&v7` Ƿ74 $\Nv Lxf1^c1{?)aÎJCdA@1;Ě(0R8}j媋zb#n#m͟ffkD`itFK s5Ye6cs-U90T1g@U#OD4| >{Ko4=&t1͸ My5NtzA6tfUjgL %UPp3"s@\:iH^*b6='WQM +: v6iӽ;m1džHY@= h)]{UQ_t"1{3fqʇ M@d$bi#1; b$Tri#Ehuiv&J=H #1h.,kEi# lѫA{QcN *;BiiHkD2Q)V-ǽ ż&v,E3X!-LP [eHslVWC@W@R柉r3 Yd S1m)c;˜fduLcFsLXL%LVCY˫JRI15+ކs^ kYyrʵi{q+j & [7,DW@б5ʶ 1%^ry n*]jdoeirX|.{ <<?~J |ixnDny7xk"n%sFj,iaHEBsחmRz/8XЏZ0ըyM+~IK~ .f&4=&g@M}UpɑZ\fSyIҞG1թoNAԕF$)r*dfʴӿh\L:ڢ98T[sQT1[c-胲 ͹.>Wq4B0Y"7.x=6\ A! !k_78΃!aZHZG uA.)aZʬ_.~ޙV|!t&3pi}JáJU-UT})pJ^7 #(ԡGObVoH.WĘ,kNBw Tm =@ O,cnxZf}y7kGzAV@|& " 3Y؝ :t+W#bn\9p'vrc4ʋ38;L`.ޡIesAÓB6$uhFLi~+sx}FmHpx]>-I#CpknYĈJX#=XB߀h(ZiFՏXu=sm®Ć1"vSUu 1콑=&&0,"3D61jP4,/xKՇHՎZ d oKlɊq#U; Rj-P:f]:ǬظZ1Dj,ٖFl*o;]Yc໼K8jEDE5nJ_8|Yvi zU^MBs5zƳ GCO(TPf8ũpjZpf[NCi@iN1d)&RkePfiD^QC%N_$ꌅ` LJ\Ğʺ6YALI l둨)Ǻo|QʺyM k}", ܂~ry!$] .ZjyCOG/'}-ZxVL`UzIm ҍ6cKj7 4gm3?K(8qݩ]u&yL4Dl8eN{y+F|gm3>*SnҥkaڍSTSRYbÔvι#I)V4hNF6U}(Uĸ]*aZNB\9C 2@` s5^&Uc1h1[i._2~V+60(Ƶmb@Cnܤdp+ϔ?8:t:tӧLcN1ttIӳ3G$)#s2d]1 `y>ՄruAe r kQYC9E^ DD";FqW#F< Y n Q-6!n'bh4-_|*5T{a?DxttӦ1ӧNH2XPt6;$R*azHpcNFkXq)P!p&j j3A/QP|)qeR`d=@f6kƒϜ@)Nfwz2LP4$ijgC61L0W={[K.ʪO(U+/}aum&n$Fڣs?$'砆5IJޏV0ɏ @nLA89[n(PHr?VF"lK3@'r>ʐ-FUzn5F7 C{Mums4KP)_w ꗪuwFKΥҏ8:tdRdNe0b"htӦ"Θo;,Hv E1Ct$LE1֭ZSr&B l 5U8*G҇=}#ޓ>Hׁt>ީCm $ׁt(giBv%׍}>p֓fd~ ZMtD^0WN,=5bu"0%4Jvfwg|yzҹli4-%܉ڄ귅~&KP:NqP0Ȑvf> cVh9oޡл ^jf{p;*>r22BՔ7%"f;D9D-1:Ӄ+թUb[dFfZqv"j'Vgr|3T&.و>qu{b"v{cɈ֢l1 aBȜɕѶ31'jfbccȈN#0cf03p#La8t9`cg#0'c'&8PӓH]KNwHڂ30G(P"3BȚ9I0:L83:)&0D Neq##Gy#,ƩcA\Ͳ &.Sȅa(Uzlن⑑ִ8LHgzdQ*pjLF'YLK28̊MSUMIhFoG{*}]ЩazF֤s@eEs4e~h7lyJxa`@2DƁ4/4ij>H8:t:t脁c :&qzr'dyYMl}) YX2*41u$cis"'iLuk1TYY~OWtoH|an%A”s~Ӎ6T)0WPveYy petIKfkNh|@dE9E:#oC68lcJcNҬF$:p:c :&bcN1;a9\-1gC30zN;q10EDA\)6bSȘ#:$*_]j$t}fJ TᶪuNzEjzJ&H48jW*IN#^`r&ơIYA>pYR&*W*@.A Ę.}f03 ="t\$|1a@ ̬(Ֆ-9-1=j+9H応ٜ}LLbqU<)eSR0X) 6b11%VV~)A`Aҥ;mUD LQ"c9N$krGf0N7 zm[PȘõN̍*)<BlӉHLw11q1s7]\s7Swqgl9[[Nc"qr)i1qc scA9hNv87㾠 aDFK>غA {1'iYnnA(z\P+^TR?{i5fr)+]*uG|:eP (~ߍWCP*|fݗ-= KA!ܣ7t5Pt5Ftk7 q'D, T\ōYāXgHjJ&8 N&c..g(o1ft'^1*|3)*1aIc "{q1U bcgD1' 'cDA틙tL;1&0$ByrAX$cEv&@FbƅXdlVܦ0^ر2'vg &0m#F#@ o1j ⺄.rs1rF60E  ݍ81"q˜c ;;"2;N6f01&14Dt0JS惺9NcF8 2~ zFN`r3IdLhv;Hj[Qs!ԍӜP]q I1VM8T~shcs$VN@bBH<,dPTPSpb=`϶vؕNS`Ȉb'lf0*NJS&0g27, d:FgƁivbi c q1INbcܶB.Qc aS=ܩJĉVc$ jP KNuAckz/DYP!D9%TnF`A^'F UK!qol?8$;AHw>stQ1Ęƈc jtNf1"=&0af0ӧLʼn,sŘN3tXf04!1QHo32tNf0oƎ< =dRɌD"uˆX@!)D3sc;G1$c 8N:c 3Q$?so|9^q&0)sf130Et_) d LDiw|TH:L endstream endobj 85 0 obj <>stream endstream endobj 86 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD+"   q!1Aq"23Qar#BCRbs $ct %&'()*456789:DEFGHIJSTUVWXYZdefghijuvwxyz!1AqQa"2Br #$%&'()*3456789:CDEFGHIJRSTUVWXYZbcdefghijstuvwxyz ?Iz>SqLZ(wd%BP%B ! T,D%E $KdjYB "PBPR%P D"P!BY* YJ5*TD%E J  PBT(A (@BB! B !P!BJb!* J"BDP!* J B"T!B B3B2PY:q8'ֿ2Ukd!B d'$PY PB%HHBD%BȲT(A,9P"BK J"B%PR (@J*J"d(AP!* J"T!BB !P!BJBT!B"T!BP!BB !B PBT(@BT(CYzq8)% ;̦-q*J(@EBP!* J(AT!BT$PP!BY9""r J"D R(@BB BT(A (AR%E [!B d'Y! D%B HIeB !P!BB !* J"P%P! T J"T!B $J"B Y PBe|kn1>^7yբ3]!-e% D!*UB !* l(A[ A,!B@ lKdY- '!B EB JPl'Yޡ'Y% l"BTT !*,,Ȳ,dYBPjD&B!P%P!P!  D@؃AjH;YŦvH5ԙkT "B%[(ANE"B D!- PBT(A(CӒ^7y,r̦YhxԨBDJclPb,"(E ԩl -P B J5*ue  l(ARؤ %@P* KnYBE $NE"D"PȲȲ[!B ljBJHS+ ,B)P(@BBnJ(BI瑼Q){caZ>lq:@߈.Gu.SSgm76VЕ  BB,BJBP!*,BT(@BT(CԞQ̨̦j{VJVPBT(X!E(D%H {]T JoP B(3BT*(J BuBPDEA,%,bY-dB , AKd(A,%,,(J K' ,'X"lW} 2q(j%dBBPBT(@BR(@B@$!B铬e5:N7yO,ne#%  P, K!*,("BPdK DT,T$UD! J"T"D! * `" B((AV@HT@H D%HUB*K(P!P!B!YB!* Pd&74b8Hێ劫&gCzJs>aFs?4)-6"}Njl2EcDo.*7='W ;+ (! Kkft X18ld H9Nl$0xnʤr2Id2#vR`ڣkIJ"B ! T B2P铭e5>N7y'Ѓ l+ IdYBP@* ,*dJ",PN,T'Y-.l'Y l D%B! !BDP!PR! B((@B`!BJ(@B $JYBT(A'$P D! D%B*]S.]6_B8g~'gamJ3mO 6>D<.U78daHh}S$Vء$np6('آR?$obB`wA[*JKX w)'B;3 B-+(Ӽ}R s sإ]Ie Y* J" 2NIe듬e5I'X,B.PdY* 'Y"lK$NE ԩl(APB,QBT(AdBB,d+(jT!BD!BB J"BP%B4PP"PBB T(AJ(PJ5 H%B,A A!&N'z/6Ny rQ*D`I2^=1tg H.'](+"!ptO%)RI{6E|u$—J %%=OhࣲRۼֻ΅%B m3FS9eJbT4V`>W!chqgEFS8SN>?DŽ0P8PBT(A D%([(C퓬iu̦d%P!* "B "JBT(A ,%BdY* EB!B)!P!VP$J"P!BB%P%B YB%H R(AR%B9"P!*EB $J"iud&ݩJPm̝N]-n`xfD\f]Ttrsp}7Ge+ZF8ȳ~|jLEǞa׷mu*6)p_#auVB[Yk6]S *sp1an -3 {茭TIA:pG+[vcUN5݃qQ.P߂fd m"ؠbw!Wdf긖ЧM&[M;fg0Z.:2 xvȂ;BI%aot ZCErdEKJ2}$I딘;G X-Gs:446c|ϙM~5qfs:&:Vs0ߙ6Vʷ kV6%h}`;W=}6{ưa{,2zLU5u<ܙwݲWO>0C\ &GL!X4U!h4>Iرmʗ\I&6[Up C{h!knv2YZP.-0ru*jTש}|m q.*,@nìv)CnƁ|GEqRw2pŢWl5 K)nvPVA-CsՊ@N>O`H\6"7Z-XkΖa~s]4t2g-;NZj[ZlIICe9 JXa[5 Nk\-fD[6m(@።TFXd͘7MŠ\U")MV8"ּ鮦aȣs/C74+U[67TZÃq4n¹Z. ~5]Ed/uDm{4I*;N#okaUmܟ꾕ZBn-b کQ"n˴RvifyL.3wZZ7[>)4r\.s\e[lݓQ%#6~m0XAy@ssW߽ X4p=51Ft8~P imMo9ٟJ*߸ s`72$URYG50i&yÇ=+ c*y@a~#{ۂ>X>mܱ tYuu857$ _6cR6d,qpc,MȵNA&1H\ւ%cyq>%sI q-yR#u,'9||>zˎ<fasCvG[bMw+~J>! Pǯ"Q䲴V`ĵF` L.콏I(c \kZaTOI gyDD %v Hθ8P2DBT.Kd!BB퓬e5>N7y PE(@BJEB%B PBT(A K%B !PP BU", DB%H P`!B@9"i%7M~7y➡B%E,D 58oQ<\MvGnlc7apo <-r%ΔŠ<8vK<ۗaxDqљ ۻErpu60I',%dF#DLIeq9S;HnIϊdX+fFaw@TV?6 НSY$z4t>r֐DZV5Ǻ p,uMux{1G,h d0wC*d[Yd3 _ϼ_%vP Lm ,-Gq0 z_m*jkU(v>:ҝDN,0{ =CH o$\_KxcSbNI"FJڭh#ڸuX(ޤ+:h+[@-$ lٍ \ `%o: TG#EivGpXTӌn\\RKew}="BMeeE[kpU<*/=X\X3SBy71<{N;O*+?,=c6 Oa2bh/3uB^qkiigsb:@=Ҧvw+⣑h A8lw뮩x/w(< 阑Dv ,u?tF+9໢X`}$+hfɈyPٷ~]X,.f|d51=nn {v]:%sIS x ^sgT ر57nó-g$a?7,1]5e]MTɌXËqI=Ȩl"xsb3]63 KK#p6.JmY;2~"| {WYJE͋l<]S a.sA"Mta>X"K=r $]`)* )FhU >6mwT6̄^4isجvl7f3g1ss h'%]L^GC+'[,'\P6;PIl)X,|ZΚdbcZqr JPRB?װe5>N'yPBT(A* ["6lȲ JȲ Qe"P!-B[!BB[!B dJ% DJBT* B[!BP%B !PdI\ػ7d;>ʄۿМrQUn5"RlrFobt:%;"=cCGiQHb0*I Mȸ[U Ŕ/e >?2lxL;UFzc eQi[GUL=` hr qSa7V,@h"_Ħ *&`_ r #I']"kMR#d/u.хٜFjiqᒥqѻlunh.9u m)bmZtN{1}6My> MH*8*p?ew.yrnI%f"ip bGwb7!tҾO8 MߧnԴ:Ü>Rj6 N2X8eηi_Su>m+D.=g*sq`CK; Y4! ~SRh11ѻ  AHVRn-wJ*MD׻u@'Ոg:#v8m'QbHGI5p)-st*b x)ݏ1cu@ :juq\=@$VqqLRʝ3:W!Y(|op,=G> iaN\`pq]ES')V&3-;mZ Kx9I3" -q\<dI (O#^aC9qc>s{H\@qȜb@Yw0GPeqy|4\q!MTaN&d#ekv}ETO#K!4x:7jWrܫZ Mñ8*Lc\ZpkY0Ɂ.n,"n5GT-DTt圑J :2р昢\$h=uՌO:6!qw)c*h'<ؖ }Ilua'vYOb^;I&ËFܣWn'&g9,vk; =F.+:FæN$(^C w.$TqBd>H}K,ֺCr^tk37mchsp봗Ykfy)a--u:~rݴnIe\FJi&eIBWz#pj֔G3wUs%ܕCA?.m-3/9_rxu炎 (Z+ nۊlmS"C<,4Ǽ9IQKP4,n"Y* JбS4!PP%BU% "Bd!B"Y* EBIJ, K!*,B[%P!-e"P!-BT(A,$\Ѽ)-l,K mr2xoH q$x&kO=ڞŜvȕ ݫO#~zy1CXtg3Z{M nwvg9gY#8f+ ]K:3vEmWk X !d$`K@D]1xI66el|9ba-ۙ$#[w[ X354R8"e[QQ=$r`9JrdHӈ0@[O-(sۗ7ls'<$KpKBn1Y̝}1,.hX4+x܌ `#*z)2G!sA,k%aZ)Rv9nZSʿBp㭲 K tRw] 8b{5\`M Z)1Kkb{""a+^+cyEʹR40iqmi@BT(AP%BDP!Bd(@BA*JBBUHT@BeEJBTe  ΋`^GCs;ui5F\[M5cF~Hc]1ؑ˷3fq|QCĭf %n!,Nd2Sڞ^,rͺAX!XX5V{qE Cy)5=c<ڭy@6U[qT=-XkH[p-\.Ӫ8q[ZLB[s{N"F7Hnj,X2wJ]\r+uȧ63prx-fMW:J4ګ)"rTrz4I"pQ*TgC~{{U~{632s n_b aGSo֛U3wJͬ/A*A9r2D"Tvgcn/mH/ܝ(HAl @k(Fg{JJ wp\qEk(o8L32<[qDY=\?&ڦ:kX4h$ 5 8~,\I03Lq$ѽ bihߡSNn>>.[{nIsaek zFg#X^Hv#$9e]l͈- ,E˕nmdGE%& KH D 8a? s:fy3xĎ{F=!f]UǷHZ0M|iI ~3 a2\;6?FslUdIq1᭻kI JKd+J2rwPBeB!ҴXMOM'yDBd(@BT(@BE !PEB,dc,"m*BB"U7k詺**ǁsaN{6+:͵ix& r]'S]Qsgba&֖6oJi\Qm3YuXlpxi]c-0xN!r] kM돃nn]FCr`n mHZ63j V帄\Udu2͖d>ҜBAso٩⫎.~1|F*u2aM8d:Nj1`Ucv${6ݪtOYc `p̫m42s;ya#tK ,T5Ip!Y~n2rw-#0Ɓ6vPPtcSr ^ՖYL 1E`-f?R4h׊9ZK!v(M%2C]#0ms^69;8 ۚ{uRM=Cm=B1s]6{d}dB''R+X9Ƴ˦K ! Ȝް="ӵ9ՐPiw93h'3uVК~k!ф|ث-nz ]IDKWGYi*lE$Zp8*sQ6> # DM9$70njL˜8ht P#L_\ũv.,fayc U܃=At6V9mrw+ޝԾJjg\9s%ڕ>xydh@v\ ,}p]jJut[ +=B ؕψ.ou`΃ c䟋XK\.IhXb9(M"6iZ>FN|%7ڴLiUԕZG,bY}#0m(XFTe)'e% <@ś={.b,lufs:X$ gIbvw.r܎ʉ3t`ӗt_q֨}#j9+04~x o~v*5J )V -yz@{RM #! lO9 TrNYCYKT \ALVzNGҨV<8w 4bi2m .3bl5s;*/ kZp]T:rϷŖWָ7>([G28maW_t2))O.7$90\ 蒥 6·"A>j lЛS%*[w.{9-EDK$rE  P!* PD?ӵM#:NG6ɱPBP%B3PQ[%B , ,%B*BD* !PnԉPY PB,|ʼ[楾,JU4Zti+"\bFF"cs[w+zqPƃ`v \cLnI`f:{d(kKT\DvۤXv]KYk#]0G02+tAK-3mݖw\̡{Á/̐ -[HkF qi,t>XNq9+i5q|&^ĂELE{rbD-Ty\]U#vu ~gCaqqq2I^޲ڴiD1xZ7#f6!T9+MNs\qr5h'oM۫LW8w.6XhN[,ȪccONFbmbVIETZ.N=%C[)'5E Yw亢NTPYn6̣Ω׹6o&4)J_e.Zӽ6w?h:AH"g۷.1i<)Z:] sn\z %wfﴸ+cD1in?f`94b S/-ˌTzZ+-$l,3&*Jп{D ۑ(iM+Q:fG0\ímooY cp 9p SY9rL-#!r,7)ɄŊrp 8tY\Ge(%gEһ[ҹItf+Z_R \dn;y9*3ޯ/bsGH:ǠFa)ң-+ Om ^ÿs_-Vʩ"E e jUt}jJC>2A:f!6W^lIFOz:#j2ryZI80Dn#Q8[-UdqX ^@*-8 IR>7XI';5BQF%؜mjJu3'3M_q♳k{jMB^m .&>9#q[;i˹]U$sĜN6sqARKN#hmMζ"z]C ŞfJAg|d, T@62AqE)!k%Ea5*݁5'$ ɧUhR4buᡦ+eـr3\GkN}{U$8E c·wrD%B`@DY T !9"PBTYBԷM#d>iMKe dY:Ke ddYB!QEBP#*,B! d!BDPY lN~E) jbC g3ڜ$.kzF&>vCrtdDZX ;Bdmzyl ;ebt)s?l"c]PTO 31ƁVfr,3.u`_0,"'(\S 꽫0lQsq sA}5= [*__X nG[v[\R5D8˲M$vųꦭ܂Ѹ ^.WCgcjnSMi/"eQĜvh4 kŧPh8OV˷A1qZ)ʮ9H@.}JШ R\/Kwȹ h˵"W.C873'5 q^90v8uj69_5tquIς;p,7PAʸ{ofTܛLȺ*zx\9U-F1%9J$tYQG:Mu*z3jH6[7ZT2- {TTv &5`ZY m;I𛩣BN!s_aRt~©q؁"O5ed c &<4ˮLgK*mȞ(8O-e[)\ α.I;?,7Ȓko] A r&0mعaTV,r`nso{>blota씌ӵӵ.rolp{fܝ^= Kbjֵ /bqV& q7 ~EUE% QHLuUqJ.g0WN%,.764MxJ76}'kx{WU@shQ#t?'8d [`ӿXlT5vh~ҡqU c}zg8t2pn k]{NߵbW!Q[iTtN ̩?6wfcUɂ6x Bpi"q6 )ݓPyr5?SeE"KeLxesমʦo̮TnFnBؤ é(A݉ZsM7ޜސ%B=22]GK +F>,9߀ hb/|*;dG3B[!BBBT(@B׼M#=7xjdJB, "BPY PKe"%" 'ss܀2 ]Fjg1n}Yq6=OԗU>9wk]櫡$nVt`bJi,&FQuJn9DGn ;S4B .w Hnl\H@ɷsTT:&1F%.=Zo 7eڡV*bY^4ggAsO ]4gqߵq1iËp}7uPӛZ/(I%B=fU(TPb-i7s'1MLfx`M͉2>8Ż)"3fI=~ /}+D`t8%I'(eccvb}2&;I66 <Ҵ4]BSmךVěؓظ*궋AV;W3Jab2G듖$vRRoMYaVIxji#%vˆ%l56zQTb.ܳcŝ`˝iu#3]ɻF# f߀zɔL8q6:dYlh"ͭǽGLq=Ѡ]Uέhky8c4hp wK)ܚ*΅𡠖3%4]϶>T *8Ń򾁲1hح :Eu0959ߦ-nguhƻdwR|!Rua% UKX> wԮ|MS>(q:Rk 頁/!pN6o(6ȡZL=RVM#iHPcrpQf(݈c>ۧP 2{WY$JK6RvJ tc$ j䤈UÊLᇵϾ~Z=r I` W51ڎ4u-:YMfߦJJV[l4EP5OgnSջn1". فu]0Wj[L:Hgk̀U5fԷ&k6릯(>Ǵ@l+~@9z r믽e''E*̩i?4q:qQl޲i*dg)ikEWV%mݮzcM8nH4:UL-r$w&tkg*-=뢚] kљ # N VQBh8S*(MJɸ84Yq(%!.N6 A!u;dBz/sx~RU  d*7B\vN4qVs81=k&6mpﶭM3`%Oΐ;~g&'ؔ\nIts#6]+0Lע$sHwcnT8jZu_WhG<8l)'[W\Ε4l5޹IVtqgE {o䢤HJ+Dn=X)41pWNЋ@,$k齊c\}P*p:hSi%nV͞-jXS#l3Ƀr9lt{sNWmCnfPrf#skl,,7=EYBɣ8pS!{°AJҴ%؏n%]ѷѪ瓟\ˠ\NNR0XDHw \@ jq\] Q5$f@\\n=*z7ҵᡁu4da՘SЋPG˻(qlJdz ɺ6qm'qFNjA~L7@sȻvxҏCgX7YGI&7&?yRt!~QN5N$e[[wĭ# MI剿   t|x\,GyWmi̓O{>j#6ŬP'4m-v-،y;_tWq#ZkHUẢpy6w٩ȸܗ9UN{cG pa|A{InduQAvj2,ږ$mk'yBfGwUmec*_fۑR;QK :e2BZǕw];C[?湓 ea6)g7EP/Kgd>U׵=, [_M;aw@k8FӲ47Ŝ[aqIJVɛY|V\;γN拀ȲesJ鲄jr75 D9ldmEjGx<6Fek; W==28BEمea깚,ol!s<ȷv+1 p 9h(pȊzY=44G 󻵺u<8F -46w!(qgK;agҞ\|7#1t66'r:9塭"ݍNq'kgi9ba -$06 \Z-{R>5uQ45 eWbeچv/NN =B.s*P P!-e""?иs`%["DKd* T(A,P%B eKs:B8jfdM/sGHSDZ"ir{\WEk˨xI[q%^YOw6 ޡ1)k,S@kr$ZJZӰ'rni,XČ{1b7 Sץʹ&) Z@uA<ÊSsl6캎5ށ(7s "!ۻKoGQ ||Uq}DC#bG\OJag ުޝ xMUER#v3Lfupuٝ{B DzȃcUiLEPVS %(I 4ؑ;ȈF@)@ʠ|Ҝ̺^K. y)6S\:7$ ipUln,8dZۃْ- "C$ˍ2> x8x+hFCn/޺ϺKa1}SF~]ҕָѐY$Qp;Go\b*Lz MŴn,*= (m Ŝre4%:6EQW#UjeiZn{L{aܽ!6g6f 6ܖ$Ia{sd=~1DO˘2mC$=~TZkN:4-nLf5^GYMSP .̓tpl<-qa=^vb,%һo si _ #] 8YQ:BJ#Z_kFOT{I2(a~msZ%F/+ŷo$s[OF֋s6Ak-#pQp+Kck.ָ[[jg$2]TdN08s<2\E1CN^Zo'.#m9xe狔 =[I/"+8=5۲!I@8% P0oW d٬ϸn]t?{F 4U rqNYΉՒhG]0{p@[ yۍW[&Z#.+VTR2 רetUa1ay.z3 ޛ0%UlHXȰ<K8QFGSF-Q#%5ZƗ2.0 \"stE+J' IL/cf7gvEj,i(2ky$~;P㗖K446UasK |j\*^+HiHn:E%Kwj7Iv u-g7q:HC tl h,.K% :qas0@2cۭf_'ݿ*6 E[v /Uե `JKһX6si]X .J>:'AEw ګVm!.7V : dNBd'Y% KdPһx%"8 "D%,b!-.r 2Ԩ1'Cқ+# `8E۽ fFCE3]wEMCCsʼnuM ckvWtcd8 ~ftq54 [ i45JtGwk7(`4I"{#./rml 9DN썸}+F$O+iPF>XOu*f.@Xsu:(GV4/v*H}0P,#RjrFZ= %'0֊u*2$)#qz]uCA/![jfokgz4DTӚajh6Vn{MU7)1oa4v(w_|ʉe;mX[/R^)hJupptj@Kb/Nr{>ڄ0mBa!uD11@WRtEdх)H itoΰ7:\f0S2P8\9&b96QIں V{JRUr}&-d͈&kvM4U;.7Y-I.i7&5_|I ߍӉ~\b*6H \Cb3ďf̬2Hcٞ˪]m*&Z]ʆSp^uxfz+HLڶl9̏=.4nە٨l7M#LNީ^ֲֹŎ:a'2֜O=vu}-3pbmlj7+O <ӓ'n!4Rt~Nr8pkn]9CJع8\%p"GVHčН+mE|&y-c^[l cly# ۤ[I[z=)sjcs/M"\g4M @Sv Jݾ[>cc8piŝݖ\W$T-3H|1p[LꙪc  MÉsIK9W0DCKm|WD.K ~0D^XC"r{^zzr KXl7]('6iYCQIQR6, ^[3,5TI%$8sc k}5 ܰyhmTܻ*['e!p;wqW[1APe8TE`\ZA4ieR\ޑs|Lw%<A IPZ]HhPlə~p)spsDk(hCOU;20Rwn׻ ;_@ԫ!s>w>7  ynh]BY(BLs ٕ],M4a Fa$4H{Xmt ikK^_#]wwW q:8q {^ޥax?;,o!3OdC\e|&8 @hC4QUdLžЮѣ:OF?+O@yu򣅃b陔N# < 923X$2M2-q-6ͻ,c QRueX*:ĖIn%dJ{pxnSSP:VKs,wlgi Û:c"hi$6!w.ڦr|& H *6<ݸ_6?ynQO*tN5]o ڪwrQM;>O&{9~,:C3aQ,9F"]TF ZbGӢפZ5bj ^[d[\H)v@#vMc S1k͟b{O#PKwsKF{*u URf& %fO6&84F@IY<ل0m_U3w 5TΧu"fj#m#MoqN.6>36ךRZ`'U&]-dH: qpo(&$lGk6%){A 4>dL"eHmIlZw aTl & wwsξ"h$. axdl0BWBEViRٽǴ,WZqOwm5I9[%`kN>wKi7qҶW: zԳjgR6FLJPp26z[aXd"U[>̧e.i& *'C{wzMpF\2*ۨRuU;NGy*96ǧ%D/6ms@%ې$0kEcRWh. f 47xg*f)*ݣHZ#S_щ)_Q ,~#sq9v O$ y0N"ӼR*jz&sͳy4E`i$nNTNVےDhm!%gv#HS/䬙ֶB.s[$qQd(pf̐7&YL&q;A,_?"tMdO,!`$ߴ]"5*ljy֋/{*$Kc ʸز䋖F^4soiu5oK ‡el催C]/Nn+a*ZOgҨٵǾZGH{u;8FGx 6c%LZ02šemxeqKstTFK.I- Zn3@«Hat F魐27DG`mN5 ']ظDUAP1o5w!{vNhYF.n]p6(1G3 һfTl>1b~o-P@&,/s\v-e6N5Da2"Hֱ]M"SO8m5f}+Mj oΖ&JW,\-Q fS:HvkښvB6ָi|B~FbsuVg-g"m]+7oU2ӸCqԳҖS:GF;q奘&4ӡ`5p!ɲRM[ˆz8ba\r+K#Zn*X\[ۙhH[u&۴_\;JKLaNC`.5ٵB l8\F/m}1żZ}WY違ΛyݯzxfYpG]#Cڮ|=QY16w|w%&tgpb'*:C,ψ c6K#b.8ƾv3.m#?Ƀb{K8I&ݨuZc:꛲l(mSz"K ,cڢM籤7 ˪-ipkw)$m;GN3 <v2B<Z_r2o4~b^Q ivnvAT:9 F=oI6 ^AKSs? 6dt˹ivw(bqx  nSR@7+ݪ:,3x=i9iDE'0~Zi.ͯndBˍzbM"Chޑ B]-J^š"=P4#docۓNjzQT$JBT(Cӻx!#ĤF*%P"TBI]XM/sc^ eC%Dq.̯]Hw\v 8glRH9mBVys- #[=.&Gyek~5s@$ķ. CAzR}/8cA+*EL`6&}+ESS e^s8nMhZidsq6Y't<4 O suOq_7+(bGzLg]]a( J%$lm%.O Xu8B["k1L4gH+ Fh>xV=0S2*d_YmJm䒒Q#ZAfv iCjlkX܃@@((#dE3}QUn4G(Ҳl;m +^d &ݗU9璪gHI'y74\B5'm]6bp du$f]niQ2_,ӸGnk {2zi8= ~ o6&[oUM3c(WI4rъ=(fF3!Ž- je-{URrrI#1:ش˽q>KKKOerc#yծ' avi{Ph%)mעV3S VZ6: =.S>LaٴѥmQS!̵; vǔV2Av< C8> o+H}Ln->ލM}]vr'4呰]QS%O+)s^5ko{kS{3]互=^r7 qqh2Wƭ1SW#F1 ׂ<ĝU1V⣳ a;M65GPvnGyMpYu|Ҳ2>$qm=u,a/1Osb<Q ZT4*TTFe{MCYNm<GaٱǴ iuo-|OM13vm>ظ+yr9fWoOLI|)1t!.hNџd0 w~A򩡏&~FG[y$}}Pkz%P;D vsGc hcllk,րLs$[guNuHi$Ēa%@6 =ĀkIr'-[A7F-q>*UK-$Ѽr3l#5ei=ғ߫'k>,[eRh%uEj-%YkuRd PG߈.+H&8<R8Oey>c\NxUW9tܞSG$G)M9 n<ֻUtu-^iWd3 $(]a ՠ~ُuo] '/ǫ%΃%sb~ɦ#\HpBv#6H/yNuꪚWQ;fmh$S~b֍fq&9h9*977UJy9]d}Jj75Ķ4 %]JL8p;rWz^h@c4[xUdF։\´F LX`}/(],{I%RTFZ:+/pA??*:V,e hxm-h"*gF3; -e(']=4ęs9̦K9`hsKvZ.v48j1#w&F<`nwkИժYt8GZ2/Zm<J.q9@2ٲii": {Тn7ʵ32bxd$Uό[k SfrG\ }Z @qQM +BPa60nmP 'FT!׵YDfZ9d `ZZ-`r⣦uT1Ùڹ ڰ62^NF^Y!q̫(\SHsg41{H3]WWCPT !Jc],~f~uQ p3:# ;ȅvXa&mmyh3d!Ը_iR]LD-i­q2 K#Gh%ؚ{ڵ)k^,BA3.'LN2=v6 [JGR學\oT;,`,dHmd(JԝO x#Ȳr !9RY:R ٢@w;7{sdw*> tfmffۇ̈́ =ݍh7?*2$F&'Y?p_c~B6-0E6v\y޺$=,y;mwWN4w/J X#+dNYޥפ\#XO4&*hE0*6lh gk h2u @=MrriYͥvl]|nݹحʈtu,[F[zU9m;NfKӛ DZi =G+A; Y^78bӗiڮUQSʩHsSnЪڕpR^FcQPvDKsmt쥩Ԃ'VUλ`Ա7i22*yHʰ]gaIC6t8`v׸hȝWO)e..7VMMV&;[C~xH#%pt9:7n/GUͲ`=6|Di)K㌛2qna"l (:l!Wqi\t,chpq7W X-!;Ս rvj鮲o.͊?)(c^ tx1{e|RFb\*7J$>J-Ѕ@ [̬A9Ҵ5F]˘0-~Od,9QÕ>2Iv!*9! Z} R?~Ӕ $T(C#T7Tp_B;VCkG&t sIX#n׷Oh"ȳ皆%0\]J uss"s0}kAX~G.hDZm U~;ǁ$4{qTo˳=8[15euZ)gkNMH3f40 s*$ٽCMZ#%7;V{c:*m_4*aaFInsg8 a)ԁ>T=cD9U Iᘰ_y!SY6)dN@;/Kf5ff9]aYYv^Tt"xM5,@]{zfmpps%.cѐr?Wi02g$mo=٤܁l]*!5ܶ_Qm+0TSpdp\$wASO\5`wB plZGةgj4hKqf8x~GYue~$AΆ b͕[LA97Nal:$f$r5Ljc}QjGT٥٭q^䫊ҷe.3Wvk )2"NjZn lHMP#~ $Q֙8pGcqmI WY#9MArsFh!JdY#ۊ셏9CA[8LNdݛ=%VTb69$frlѠ#*7#aƢ@4N]lO3csDma f#_TSrъxoc@OAQ@谍P}K!Sce&FNyje Uj#s(o`[mj2JT-kJJjwʖ .9墤A=E3%1OEYF˃p*7!fq*x:Jq daV>{C@s/r wZ dGkc캓wkdMi'O }!0ypd0̲h$)C$!Ql?UkfW'G@{\_%mHLrLo ȱSZHh9 =(B4IU^/3c>BoIie ~sH[#VZ`;:;X3HNbh Ϋ@5DIn/%)b!dV{&ϱB45[XGU2RTZjW87 v}8C\t a;w`PHc3NNR) X z+#n'}s;b]  kZIZDb`Êu{87+7 p2<3]0iLmCNQub/98` yuN4ḞF[82~4У**Eٛiॢېc!;hBqs#&^[q +躅qPxz,ٴu2߅80ms{mf2$lvc8_ Ct nqŵqkYډ˷ص' [f,-vA$eﺒ߹i#`FB\hF㌂! Z kA$5$ML89rh%kC`,l[p7NKG7OPzVܥHY)^,fwim􂻆\{ 4?qT!ؘvoO.zAg 2]G(sSw'3T ^,269/vd1kE;IF/v[%BU *&UG.vEv#>ٳٰ9pH}]!'ya\ *S^$l"Ƕm.boe+OĮTQNյ;qdd;+c{*D.,/kG h(!7x[8` +X.AeLhkF!w[ c$ͼG^Hrr֛"˹ _#G4|H< 7Vēt./i8\-KNWHC䍢ٵE0 HyaWT):ݥ$f)!@ts_4"fq <=+3MkgA߼(+#vDCe445r3SK̽*E A$o$j idDܹA+Q+ec V7!lK4gedXF1ˉ@#3:Z[ yewvGC&|L!Dߑh$eπV(kai#2Je~!4]`p{%&ł7X~G1))YT٣{[Bkn"yؙw[J=v-r^Yy śKF__اt7WAMUgX=V>/m3։/} rvi(ISJ¦ yO{,\A}p*"KBb0@Kuˍ6yCjk{+Y#'8E> Ɯ]h]lZ D{} + ru;6vl`OP..֝{hN JBߜ&pml&o.x.ط|X\k(mw!t (@BB! ! PEuE]P-QuO))ATT (sl uN{ .fk F߼>̤TjzP㌽%>B:rZe~#O77R9h.q ;O65J`t)fNGFaӭ lƙ? : ⳵.{$zŅͩ V>e80sNvvB§bβ:NRvYD99[>$uKDz1dlܰ9>cۜq;#!D QHgposڅbqR**YS7 \\RVsC 9FҼP{[.>iD2fpkFb>YpRqIQdLC<ѐ#IW & (Cu\ kC>X\rbڕiG kEܮݸZ"OnLf~=P~[,ųry>=naSWJMt2&OH-OjGE4$xmq Td)WTC=c"B`h6L3Z q,v[eܠHq=@f3WTDkwBɳm?%K#|gVs2$﹞VI;75u̯ mU;&,kNo%ظ-kIplgpW\ҪE+#K ^2Ѵ"r6ѨsYOo8߳xWMqs$x_IT[Z" F+c ԒS▢9\ck,JdA1r~W\4ҌN핣'a$=/5 YsjU[:y|Ad@{qeD>hD(];#ZA Nzs\39j,^LNF=@GQ:J'8Fb&ރpȻ\ G(X(P͈u*ڙ/u4e,A-76 Kɽ>Ҭ-|{)K ˨2<{Js$?-SUjI|@4&vslu0L#nQvԤcI7v9WGJ2Z$UpԙQo8 ,5I=X|=&4I"ڔfn8Oe ӢgڞӶԠl;JZlǙ'>:x/3Eɿ8_R!]+1pE}eY:HT0lnFd:Tx;.?sF-*ilvS!7+F]˸kWo:CnD19-q3Z&[#w5q+ӏ/UeM}Cs[kvɩ5&u=yZZ 5;ٴqs=pVF8]<] NT@BT"T$*nJzRn$JjEn9]PDj #k~+ym=)؎4BBkq[>[r! D%H"T+(D! TJB,՝OP. iq !2p.- -C-I/crf+Y2NѻVvMI%ǎh\Ўe7EYc!׬ÄlAncf*$` Yf[rNZ-dITu arSU[y($ņ0cg5 Jwq.xdڴMH#xs~]Mi?0-iOa܎Gڢ=9>³MD]ėQ2yNUSTpn$A,n*$j.}Zt[F: %O-qO,k.$vzlo|N{[7EH;.k-=/Z5F;i'߳}VL:/AK%q2DmbF =pI<8Vg8+kE;ZchdzD3H^F>ĹٺÆV =ZRCpjo{-/`$t"GavPS :֒CJdҹa`FV;5'`ɡmu[˰I%c6s]kzU@[yɅКg"`[FJG0M'^ "6Wzc6uRb:zojr#'h~z<+֬:ũhQ4h >TF,/}KSd![I,6sg&t;vtC {2;Z{\wýKmM:% d>6b dxE.V1=f#Dg6v50 h$9nr mnvzTNW;eq3FW+Kq[f@^97 ^Ů\ 0ibVOuUovP _ˑ"jƸT<>kzHӴK^pOLj :#/NHreeO{!ZI*{gKM#u@"@|}[{d)K .Ϩkdn"q&Jnͦ*[=܋kdʓXhI.p1lR4Ns @pql +d,[ \FPSU۞>-Nbc$1Xokz膮gUI f2"uorױU!U#鶌 V2m<{Vr< yœs ʣ#\0IjrzIN"g8;$dž-u_YCҦr=#؎Q(Y[DIϳ88okErnQ: 4{e5e59hᘴ6$z<ٕ`r\ p~ 仌-U@-okqE s٢ؔ3XEQȗ)|mpaޮ$oJ23nju2T4aMu;II~Hb$^Ć܀}p26፡h ; =K9BZ ;eELeNQ9ݑ {o" SW{V{l85 /`Yޫ)@! EAYQQ&t$]p{b*]On̎\@dShC>1ǽS^uaM@v %%BPCw(X+R.qį P(Ac9,JR. T(@(@EB E"BD(@B՝O))@TT !P]n5BGk}V]RںÍ2K|.## x8Gk WNKoeK52ۋ>Q0GWHTQ wјݥ~v45fe9*+l1Hy_+s% n+M,Nv憸,u\4bsm۸1;{i CAy^WPOEZ<ܹtlȶs&h* ti=% tRHK[Jnea#J+ST0.eֳc14>}62G1 $byTf~Ér,  ;{ sr[3Ny\sEͅqs{Z5Ÿ@,61a{2 gq* !؂@_lF{qDffecfۢ/C 9WpZo}U$nEB`IRJdsZDw &(V̌hi[.Ύ0vJi9.( iZݓ%smn'R\6嗵<\|'j>3̩L~ȁa2 .NUWzRʌ `sam&?t G;54b69$d ٽMul&N sҶ1 H7n6l.ΧtB݊}+ r{5RX,ru!ٜꗌWD#!޹ݞ]-yXڙ:F8ݦj p\Ww6hJJ[c cs("1{ ]=$$m:zz׹-vه ;uޑf `رF+~³\Mg.NM}EU?pFrx zmei+nt2DF^,nRJU %u;9 ZslCd Y X^ʬJKCa7FvKSa/4koZbݨs[plF̀`3Rl㈍֒N` lLkt.$.*@#$3޺ J rhJB|(.ru jR%HT j%q$7JHȲB["D(;8w BTYYB!-BT* J"DVA,%B?O矼/G8 Q4#UB@]}T%q}bh%@sNX#%iЏXT]lz\%h sdBTbCZYhr:+*m!hOW)vffe780 TlX98L#)heiblm0<OZ딦K#g f6IdɍuM+[ 6{j\YO+lL!؀_3nlf*l#&6.n,Ww6S#k%h<6@. )#J9:Cn¥nC֡Dns3Y 2gȔsOԸBpEЮ "s˸.d΢(t3E5 ='G5PmԼ#ycޮ@U4;A!78xUM"ò Ϲ/W;BcA"!W=gI.L;FgQmfR~ΡYаwa?"u%FϼN2:P8Ur6VGWJˋ9i_ E$b*f; .jϥn(A_\?pرݭԅ`.cpCW4mϚ#x\>wnjd}p-! [~z~Sn\hRnTlIt!; \~J' nR4AuM[@HPwB7jr8.2.ABJ @p T BT(A(@B.@B(AQdT Id(Cл{y49ό{I7)m@ /OkczHx)6YJ'QN^-2S. Y:hD1V0?K4{ @-BQ->ːjz4 zHTM¢:HH$ܝwym +M9,ou&3W$YӴ4X484tlÕU_r..Az1}&DοHYR+)QPc ,a\lNG%S˄͉͵\TXe$K")+f0Xf(5%j巔vR> --qy0EAIV;=d+Jک`a@f8H0erN])EE. h&$=ik#_$4$gef} ^3y+ǎ+ hWڍPrKIZ.x..h"[eE3.Cl5]4PQQU#`>tp ~jcrBRGS%P1Ǹo?" , nxu!"}b>7mRZ2As1ҝ_E 'LXt^=7aQCW<¡f]kYY2F$919\C^r#t;zaѸ|tGC\u02gU\AySv2HZuqŧ.rr"pr[7,.4mK3f M/F=˗qzu)~epXzT 1Jvd FJBH\k BP~_2FzCra7t9b!VrB(A*FGD% l"- ԩl(AKdYBB?Ѵsctq/:$&x[ˠ{8 H@avҰ؂/nYB籹\ ^6RR7Z>mJ!T[{8m#A?3_7UR}ĭw}k}ҠmU=7>ʝ$g*Qx/X8y5I&Ї[&iqzJb CyUGKFΧw>O~R7D"T˩FkkZnOzwR.G\)=ޠm3'D MZz!BMԓ9F#bm{&ӗsp^ruaڰ|,a9h.HR؜s8wdkƗ1 /c1{^=Ɩ]+dIcd\"M`{k\d#ǔsds1Hy4ygiccOA#r%ۄVє"G_˱W6Kɏ6 Zjlghb29nH':ڀӝ]k2 I^Vi097#)j&Qmz20nj+% EI+rK-MGLWI(t{Tr4]BS^k\@'[ W@G1м977ȍLR )M?tihZwGJG 6 6t>QUKP:T. K[oBbg^ KKpN '}gڸd SFz^$;C%#*杛'?9}0Rrf0#ajҡN +>Ӽݠ:K^%rvF%\wkK1aRmP El33K2So;..m[S.kk\m*\Խ7"qpPvBGȖmHIU܌[n*N3zKB%AvjB-YB $|bB)Y6hz#)INDk:f?I\aI-fs3etMLOiY$$IOڸߎh42ț^ろDvS9Yu du(rcooQP>zщ֡B2JBTYB!BD?ҭEH.$p \ίx.9yy~S5;g'ﲘIvwL&TѤV\?F8FGϴ(6@9z3&L"ܫ~WIGwT6B6Z? endstream endobj 87 0 obj <>stream endstream endobj 88 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD+1"  m!1A"2QaqB#R34br$st %CS&'()*56789:DEFGHIJTUVWXYZcdefghijuvwxyz!1AQ"2aBq #$%&'()*3456789:CDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?HKDMPٳ}<%{+ZQh\O}VZ@b52[iPxm X6!q̤􎶿pTl0-GfGʗ>]cxJS|5FnYQk%J!_7)bawiW9,m䏽:U "1TKs` ~)SL CUZTI/qn2pA~ngR2߰YScpj[y4iP0@r kzT-5_=@ Q*Z Tdjĵ qv!6F,%vcDTIxD"EaC"^C@`PNh፴d`6 ch@") H᭼FY&EF"x!I'In#t6?`PP!.D%' 4da 1dʭC@i5joH`h\[)hJL*0RmOИIi\Zxr2+tb4,ySj,ǿkX J 4=Q>V`FR]+Fq4YMZďT&Yʻ\k߅p~c1Nn$Md$+RF ~ӿ9FzJrӨvӀ:|zE( T(mp'N=S|?0ldmFR#z'57: f6xqk#L)P`h3oa›$03 VJ2U^mq~qjnM1t~y[Q'b0 g* $tsZZ1F)lZCej-%TѨO.Ds LW;)T77 nAڐ#l_!a _zYёdlv4]^61f]~ N~<4|({ŒIepΥ:fM{bSЮ4I |&@ER61b-$*wFU@ ԟ3^SRsbBT,vc-p.mQYApeQS UAFr0x睚"FMso{X`{AGE1ka`;1e2FnNkV!`ke⢳tSm5a$h kTNŨ d)g;vӄ".UE5"<)3E Sx:W #-Zp@cLZ)FbK 5mL_s!HIJmxKC` LrЀL2aqLpƛ{ 0mN&lδRo W&d6aynIm.@[k-2k9U$oDŽ(]3{dHce\ 5C|2R:;78.F 5< ;[ l(KDG`(@-NDlcndq@9Lq jt)=Z*"{(1ܩS Ӣ&g'@HeL2KV!@%WR7iTULj)Qf6 gcnKo oFG~5?MijR605\}Q!֡8ML"zE 0 en3GfӕFbu;.!ʢڽSKtL.!Tقc/I%{aZP$qy 釦M%Adbc/:I5q HOʵWCZX4HT9UKe![.ͩ 捯ʜ6,EJĜ%Jt)):[OԅZK%(2˘VL]t {Yr؂8ɠZU El#*/:0}ZA)R#卄SP̈́m MM0c^l 6;ZvɁc4ijwYĝ,oPр1U8Ly!ac-tt38!(wr`w  [1T1 `Lp/ìs$_~P,ZcFc9U!uE:yu/NpGN* tfDf.ר t {([)8z1We`-Eb] as5jmߓCNl!cwcoJ=,M7jrtaw,v#e*w:D4bG7bmsʗ`m\rFNWVԁqL p YY"u-D" ā3%e,n'&;5.u8fFTmcEƹ@G@g69ML:P- đko u4 4Y9)pi1L:Ӳo1ӍʅHDa}6GT Usab2Xf2ƣ1:T6Zj^|S sNbr԰ }:[I8-RqRWE]0jQlt $\LG;-\^OTPN* @A 8HXJWk;lohӦ&8: (SA7#c$VT#8"sm=d,]*=V9xR-|M!ʹH ǩJfd&5'ᅰ;Ȫ8(COl]GCQy3 R|k `qZhH~}oN{ 3" &;n#'mW=&ʁU\k A9΂nvPo!;)hmc p 3rN/+,0XFƢ^oO9]lsqԪa*5@(.xAъS$BI]#'Äư:1v~6F*;B-ea n#B1uBD(Y}-b}_MDP&5hJ.a*y|9,rQ R ’..\}\. \W>'?"5Vv')|LQ˙La@p`"{9 /}Z;ExLa𓈎l7M&Co1B&Zp!E1b:c0 N:&-B` B&%1Z-.P'C; Op>IukҦuJ=XYjF=; Z.@½i9PM%j!} [uIR*Hs* EDz.-U2obǃ.B-R9蓳 p}r8:])+Zx_$b `loFȔ[*Z }T}jRۦ/e|sR,^_Uh[N%Ntĝ:`,q:t:vL`0cnt*=qm5\p8Z-7rboi-neR5m55FG6UU6V@㔷U,5ZklnHY%Uُ+&z|&(9W30j{DAЙ )7p,:jtK;7txx>K Q5Ib.~SHIM;(' upԈ`X#DŽ~ \Vڱ7caU1W ,'G$7mB s)2&֙aS a[C4A f@I„Q 1֍ A$La1Ѵ\„4bTkFC3@$x$Rmi-;4 R/ -20WDR}*5qyXtJ4FuZ-ldZOuڪ/HdcsNP\ a0O1K7i< r(QbMhSjh1ԁJ׃)D@a<0sx@c'u҉}41,{bx NЄ :׋JJ)RvU>>uq$=@i::1f Nns:pT9 >,<)WkQ`U(nȍZ*TfM?ertivMFn! 2N.hRoh=JdH1WW#($id1Z,Gs@@!lH`XB" N3L`hhyo `żo iSnQ!V`1):+Li /`xła$ċi֘g:իlB\˕ .BlESbFᥣu*a1%TNiIQQOs Ӧr3^M0"9fmɘF\]<."R[)FI3Vs>I^ KE.KΞ# kT;C̈́ wKZ\*XP\ir jۏtWmuJTRċXӧNN:c :ttUQ$Y<ԮkNS*8hI&5&Xrb\pʘNl!snZ)\om@s+d#^4k*Bj vZJ"4>v*"f={'M)[ E}L٫YHJz_P=PtB-UdQ@\R_;1HWũ/8lU&&j|%-Pթ):͋Ap֣PZѱm Ns` 33Wo|LqҐ jU[ ˜&@] Vnqj{ԊȦ)xJo(6)Qy-QsAfg7,KI)ʭ& U_cGhb)r}lcKVsήʢ i]>&U{@l-`bI'rM1׹(;KN dKN/c;D Am:׊8 c+G7KӾٯ"59*]av Z5@4EԦyǀl2杚0fm>M&J wkEZ7̩ Thxl"PM:`2-TZ CB:&KkFd{<- S8"0 f0@(BL*ky!P @%>Q8i ֈb!3C&0H@La,"Eu1a9o4 ?괨RW0bX[KdM)•#L6n7[|BuQ.QX~2RBۉ*8n ոZMJ[)t[_ R̤tb7, JE+֪2df'(NL̵Q]A4PBQr9܇p8lZ:k1Ԭj%u2:+=rW;-\}+ r@23s:tDttXlbbf3%%ܡH!mXc|*)i6:6+!iNb:04HATXBDJeG#*hW!5jAUkԢFČ y׵0@[X$(,t .IU1I T9lvH&t̖U;@ϒ mbAJFꋈ*RPtW(ePiŇp&E e7\N`osXzV!l+VR3UàNYd#QbjT5^6\ܠL6&JZnwc%1죾˰X[SJjTejS^v8$DJTNjH{MOwxwj6gkc&c 2rKp8xƃyG H1tp0[CJoQSR>% l/5I½jzlPAs _/ogEJ5EUxNK9Mw:40T m$]8,%*H)R@8acM@aj[^ A u~0 9_Y*M@1DmZ0w { e ļBf0WxD&712Dym8ׄ0c`* lCl-VZ uy 0o0δ[ļ:ӯ8`"E8$&3CЧZs ]k:¡5O,CѪT.yYR~C!V*M ʠw7XjoZ$AJtAO:rB t[` H;kP8&na| qSA'cnۋKF-%_IYhp:M Z"CFR`Ndw&"1HxBS}h8S#]Đ]L '-mb@NI +*gs=x135uFf;``t-}a afuA$uZF.t2-\E8ԣ,o$+l ֋h:y&0 F4R);7EITb{:N}ʊ0'K⹙ՙ*. !nu3 + EJNfGO叽wQE1*Ѐk݆tȕ_AURcΕ( (ꃐp&8(Ԧ9ڏ]-6$:^b):.'W;eZbXf`Ur+Uf{v^%j*gbsxF;3;_0&]Ѣժ-4g`}"cxӌ-UbNO_V޽BMB>'Q2-:)SqUmpE;: Xpn/k Dg #yujծtqo:El`ZLw6< F<ŵˬ{[F4NZN5Ick>,8]okAi& fI 3@dyZiCp hQm1 vZc ؘN&ӮL Eˬ%C-@N"oh,"NZ*8E-&3`- fj_hPc h"c.=ǰOE**UYN.dyNH4 LMᆆ73D=TXajEHJVR>) uY^B =SRHq弐 K3Dz^y6P10s'nU]nn{~Y<pJ0t끄z6:wc!*v0cʤFnC9h8Kq `aDut6k r76{m$Q!F*C4,tSԵ)"@TcR41G5U\Ft8kd= sl筤`FV&3v B)-Α*XPRE7*jEhSw4gZT mmy(RqzKywV[Sxs)\A%|JeU:kܕh#(}g[=2b>YY_=MhJޛ|㚒6ﱉ#_ZN ַQaґp5i0Ĩx*m16A0 u+)ܕnw>9ɵqUSvEɷ_Ӣi^@ Cr gRg":z`61jH_3Q؋^8=m5 s@"}ъJ񘎥(g8oL3:X! f-/!{'P!@F.\%vP:k Qk`#kV UO1<"  HnNҌBȤX8v0ֆQfŁlԍaDu2;#h%"CDaiX&.h$`b \''=5rDCvf=t(1X+h :Ч@ IL;$; Ltٌ(9N^pHYDPc5E,VTE,n ;UYq8`KfTpcl1QJr*krq_yuC3Jܙ"~i$vb.d&o-Tփ\vR-kT`:NL`>;89-7-s-^)%{~I=Fcir)'L[R+\NzZ,H&KT"7Cld;U&u'Xlݲ t* bdf7GR*H:xJ&PG|LUP`)XM{BQ 8Q[^5+25r."%t! Qs5IZiT`cAuxLh z(pSGBEBX([LQL4)SqA`fhcH:V" 1DPH6rN31"hG05FH o$#ȅMW#HZd T쌀XH2&dc 8eb#D!HM277"`I2*Fک$2H#Ny֯"=S@,4QfPYs!؂/{s;[)mEŔypS*6]a}68:UFm@Өԫt]U@caƛ rX+/ifjՐb-Q =SWQrze׈#FU1^U3O5jNw;JR%]W5ziȒ)jb* ؑNa~7WÕJ9-^H$4:K*\/⤡:ܢ?#`}yeXX!̊ݪ=Ogk^+˯nZιM LfYS'pӷkqщ$TrvSb$]ΚvX0ZJĀbMowsmQ&NR65\46[^0*.IE` 13TEPT5б7ײ.A:urAAQ.}sA2T/Jc}FDfYL $ R#p[4$LJآڒ{/R;ҰMn4jd5X YkUmޮ .7)؟r22z~G#ttXk?F1@ْc#G.C~)| 6ܔHe~.8iР03qE-w:)ȧ8G 4#6e0õ9>oW˿ 7g:#n0 `DDKrjTTP7$yQj ZPv$ /:TCqԕdQrs);a7֦aͭ'd{cٲ64ji,E7::ƑHUY@.4}!%FSkk 䔽SfM`ݱ*E6F6p ]11Z匌zlI$l;SW1%]m(SP*lH'a]QZ+بZ:cq1jS}_{ S5W%2x U\-Vk)̚m4 EnN.p1 $C"2Z6@{C&+b"ג tLi4ngd˴tXZ aFPCAAȗ r$2q1I Aa;V^`K1@9܁R@׍ *\N ]] [\/$W#3O[HTbPw[,;%#-&部;KI7L|[o2%XFvH~9PyGA/BCܨs :,H tӡ0IÑ^qb5#'h'@U|+2"HVF(3R@𔼕Pn.ADvU:SK渂(g`/jdlc GRH"1jnj Ʈ/lupE=J([Sя%ꪮ +}xEVM4)2w1s3jf^ ]UH6_Hv+\ oIj`K@"/%aB?Ba،j!>@(k=+nva,3]*rF6}tӧ].v؝mNc*E("zZi =1 ] ;ūL,-%/X@Q)<TvqVL:[_O UV61߶K".$1oHǯ BZu =0B.8m#$&ٰ 0cNaSc{FIҨ,$CdۑAf=kF 3ZXnlcR@vuWbX} *&6P.)g.WbVD'!`0RMi$eMرT:ַ 9"M.t&zS;xkCWEMCnoMv8C qs!M[@!mn.zGS߬CbE H,F*vGYYF沍 ̌F@gN-SÇl$ݛAbJ-~:Gbr.c T+.롹[QXgV\ۚwodNzFeT"GA 3)r$F28M&6ZN$N0 L0^c 2@El5<;Rbr4 6q]%P[Aoa& X렸RR$*5= UQܒk 0mmmw>z_bêMY"ux]Nܥ+:WRj6؈,nHOnw'oz ۥun~IhԥN{T0s9nMt.q&%+UBu@],pv@Pw$kb&h4: ro({U2n;Q2cX`@IcH$i4 00s6ݝôpP35 gssð;~9ĭ5+jԫpI7]O0F2&`5iogtpTTP7XnఴmKVN}78Rk23"#4Ɉ7υ~j^+.52\P'55)T3Uv:Hk7r"%jB.ȭ^LҮ"͗-UqPAAEr}JUjwa)"/i4RlԍC1tJLDL/5@}muuWĺSr0oQ⊚fOoLztIOL\BCnOSL^I5iuF. nt76X(VEWM3GC|!pyEUnCk T(yg3RzGb<%s╺4};3p=fRt6mGXU(rJtY1b5]|W\o핍]M6p: ˘_5;7f(ir" +1SI8Lu\E|E'UKpNe>QTo)&Lړ9 3qC$+sxr HB4q=Hf ˆGfr|H #X  v+J:z%,Hԝo+Q݋ O9~v*<1HH.MPC1p ԛa]5*|tv=V<'Slk㿻Cx,mS1B/÷H 2 Pړ•Z032z!C K) K _M,(ÈI"r,-6Y4] a $\vm%lK*dRno03YB>j>CB{qW9PDo:h@C aB'x9,ӳ^CoxY[C+yj!Jmwc^S PA')XAMAF>d,e'EDH{崯ͽok!u4lc3qBMAy &h6vɼؗg˘مߊ׈Huskt\REQSP3[ F[&_|S@4ZV'M`qN"$XՀ&m͕+$]Il ie:mÌuKV[([JčF *>فAcr5^146$D%ڑ$a%78e k VX2Ȅ]vc%`$-fk-"[E h!1K|%>[7Xֵ"AnNm/jOg 穅a[ۤ-{mÌ\`*݉6ُIF$*}q@H8RZ: ـ$80YsPGՈri(@i_UbU) 2ZMҳ/Emx9j/QE=206W1:|sڋ) =}\1[c~;[^#.ubq@^̈cfeQLZ5NQ]"yׄ±€q(RFwm{Ij6wa`==_I*%(^9uM:W^9xMlU dU #rL\Wz@+ vk,%b4+\9<)\kނ{:)Dԓw#aԪ(T*[UMV.6wL;+]%TճtAJV()};~EC:6IEF sosTٙA#cӲ.al`@E@ֶN`9m1**ؘkICګH`5ò13]mak]r+zBujTL`F z\SqA'#TU7P33e@Q)M1*NN4BVn&+ ɼw8H.c%c BZ,Ngrz}&4B\:fA_9*O[*Te7ugpU:[WCѿPsXq]\0{uGhFCUŬR)::$VHpI\@w&3${1OP=‚ľF T{\ ("Tk0Fص('MFsAVBҖ4T\춵#~y՘2]mu#C Ԏ%YQTietVNdRjOb3 hP5SBca`NZ N3$_m~Im ·zf᮷ܘ7u"*xAm ˼DU5;km!:N33#{^SĞpTnJҘomJ(/`P~̚gjQߚ@w']4.) Ղ &'cZsm9ŵ\mo\΂ k;e`N60b.UNgWCos'ᘆ6mso.ɓ|Eq51%2[-ҏQ*d51$^굡ƴ1h8CS$!UQj;D1LaF+dn/lf\tҨ:l $~&6"OnLU[t톫PIse Xk5 N8JΜzW:촘BrA6C>vZc[fkm8H399!OTk%d|x̌4 `q[;;I-m{gl6crtguu]mynE9y]4q?$^c,l*dD4`- .vo,\4oN [a0 }Oy׬zMZ׷ZFUreKG(ս#7U} CXn|o)3Bj E}$z' E3XnmLjJ)-E|f\AQd$`Hbic~k]Ů*^;6jUZmNmqMu tT#CZ8Zin/DJz"gT(6m5M|EZU)ڍ+/|JҤ,4'ávb ZE9a^2xւBS'>`QzHفztj65XU67{HN0*U:6+yiE-)r5EcvʤteR>)SMyaUZnk_KKZlNv-B%Z>gU^=ViA^5i_˧/ҳ*{ڢ5zYIS- fRT%w.ۛ/bj߿MdMZ+Ӯǝ-j|sPQSNRE4YXص oh#4sh%jB)mvXXDk-؁?/$*1ua ^8}4>Ql3hm!qt;^9Lk[x\jGu:wRI.m\GIS:+Aʈ45)Y@nvS|=g6*}HWrQ5`O eȖ7jx\X ^/n.bh4*GHx&h 2LH2*XZvs}bI&k)n5f@4tо X1z "[D=%fV&Uy/;P=$43cYM٪nzˢT^t*Tpٮ BݙEνFZFfȇP:2HZ};F+lBC0𙄎-s:ҧm.,/k [51cΪ= >RO|lֽr- ĚՀ-kqmբjP\[Ic!B_,n2m>I6der)e1Գ[G-mawcޓ^0f-Ff HmVkxbg j kV(h#H@; a\W#܊}^:->iebMuHsQs`o*(of"ۃ:qwFr\5/m!SVag>che6[mBi#e Grrl ,+~ӂ2 YZ -`~Њ5됑kߥPXmd&#<-53P_bN>S9X_˥*T10Dʴ6 H7QM#<~kt8vlNu7%Qg%@+%z 6;2Sk2@^'OջXTRlذ[bs\RP:U "[v^db=@;y>.B@koIw Ū glaFHrt#ME`ĖD짜kFSg">L;zk/.Gd Ar'0Ϡ0`w$ 2Лq3`¥0{ 1MaQ ^raujAZGH}Y%Tf.cs߲ C!1,I/}+ |P j`6kQw G\ ,uORт .L{/\v9mWpju ka}}~PRKOv]mBYe7TVJ`MhͲ6ļ e`x? ֛rf E7%u'frrh M]|c{<PEiAfTRBtE$(,QrNSVeuKH0:NGf` WjS`G>ἕCp)!Ys'ҹ:p0ܽz@OXu>EpQύ&FSh T MŎi.E>U3scT[0JW"܍ pi)ieUmU gH#f7"Lo:8^zn,5߻j>CrFSÈ(7QV<6x.=s6'_"#(J܃vȹBIMV|=7s nBvG)bYW{_B.-ŋQ7,nhx g\=t*ՙr/&Q u&eakTmp5k9,e8"Ǜ$HK$rgN:c,טЦX;p"_Y)ú-C>,&">׳ڶ${hmlj9ݔ؄ba<6bIȻ yYNjd?TNJMM%C[&U*_^M<#jl'Ap48@0Y5;83t\A-^T qt싆VJ_+f 57úfaQ]P/ߛ{fLvmPpQr[P UMA@X0D1Qk $cUPcuSz5N L[S"mr.ݼ730Sͪٹ ?eyI4D 8!μPΧ!eqQh h{[^ +=PonmF6՗PrFisARe~ pSmc#6Ro $3H+buH54W6ٶZuAЀFv35 5s]MF .tS3{w;.dAurY@\F}QMu;_]|&0VY|K Bg[ܒo᭣ma]Yld|gKJ2b&akmn1@׷y7vχ ZVh5&na'`.|&3e^nBm߷s)UګF=S#ݤ­L ݆POE,5,ڽ#6iju>"ĕN qq &L4no6OPX@t :HHhQ@a3Z'T6ʌ.qcLHT5*ojgj.+P7{r#H Z4I ?ڏ8L $b_{ `8}dRǜn=Q> 7ԝXP]T|Xgl}HcL]1(i1֬|E:ڥeȅ,:魯.k+izԔ^;yQZS!3Xm[y2FVbi'Qޙ=fnf21ޫ:Y]ȫnOSoXe4BXM=@U @tPi._̾Wt#M|#uQrnPٞJ :zx控D#=|U0ج@s:5XtZ!#h]NSqʼn7#Z7"i,ҧL !&Ğ l,R.x 7aEhVP/ccT ^$WSD#+$Pr={H0ՅY .K fkI>^T +["Q`F\E}#'K8-(ԷuǏd_"ԥ)Ҧ.Q›`Ne- N:`:t($m@cQA"{&ԟ)~ˑ@H#(Vm1uWMn^ە"9@Vm 8 }X].k4/8q }QHc力pᶛ-Ps ~u;^uiЫ^)*jJp4ahXb(reCqk֮D1VZjA"c(Sꋮ @ McdnC.")%1 ~ɕH%-KPNq5A؋9~Oh2zG^{xQKKb蓥nZ{fO Z\3(:p$MSAe@jfNTZr! 35μ-kEk/{"f`m1jyT6K@ RRe|be*5OdZU-9P56GR"ٯb{ r -> 4ZMnͷҬuJo':CmJ*sn*k P q uK-PkbzZ=3sr ciB^ERF3p\ˮuQBLH* l6e$rT!m=qR{Lċ[Omm#"@hsx[4RC[t. #E((uTѕ+{ 0s0or/^XpSR]˩&ʯQm7mHKtL$,*74F.(Kn; \ #C11kX(HX`{vP((n= IO@1da}6p3ӥMOj.' GDp܅c wQz%j7KSmm1*bP}{ &z]Q ~1[FRo4=ABz ^-a6b M0Yʤ{ ݾP`3 짬| :!so.ڧ`KdE'ntmfnejGǼU` uxjVʗcRJyM*u-R7kɬ͵'-0eu}/k96)`lA=s57Yc MOra){q''KZtXz{[m$>O63f k# Aծi5:GV'񣓻v k ˛2FhGg`vٝd4O:{ĀGI˜@%Z[_kKp!,\\9㏪ " )R/D灃!H̷ݶ727/C}EJ9B0;߳ne1΄₞GꟄ~XEK]uܶ{;XЪ\. ߶u˩kxL5_JK SpT{vVc YmnxM?sl m7j*.+S{::].5V{FSJ4 y0dq恦EJ>[XFh5%jS[bʝh 9a: 6QfR5HE :3̌+]v*ՎgSRǜm.,}:sL9ê>XdHh1mh[żH8/iך СiذKhmQ+R'+/m@HZlK5Bː6n%SԨj-E'6:^?N% h{|D\ܥUӕ4V3{!P@%]mBbC%;3(r\f]ER3ɸu)׵^csRA"l͍ W Pf iQ3o2A9kzbkA(CAS~0=ιjKlXG2*ݺX1bbI6&n ee:x 5vƔn'jos i ب'@,/L`mfRG {YuA4:ese K1$h-}wH \V(Qꁍ^Л&g9' R(U ԋ[òi--Et֋͡lXc$ qh@7drNCo,rmm7 ?" H!u$ikp;Y2TΩѿI񶺝𗔢 #\dzK~Xbmϴpo}oܩ9{"}8E jN>;Nib;EoH /rU-؃bV :jirB@Rt6>RN8V O6xPuF{t˕,xQr-z#͉ [N⡶7r PcA|g@a$nZ1쒤n[?/dZC,5_٣I=uaMH2)vn^m"jl SˠcdKK6[Tv ~i ta%Z=fZm/ m[$v)Rm.u>*(O2⑍b-]i:5A:[^r쥴[|'!ânÈ#e1+[u"ШUgmoCXZ@uPEx ' rKJs%-y%M5Frڛ;lEyR |{ mh5̖QMg,,|0!).jj_Usn)+nۤmΌU{F=6V9ܛ7P/~#|Sef}9T;N5U`,.,Ek~ء~26ap/ML: ^\* Щ+5jfT5lo;%3ӜtI `̜on#e8rFP- PC`8Q$L0pRA{ SrP#O_+Ts^p9vq9G¶@LTPL$I$'s 9ݻvp\Oם R -$n-LցDu:G 1TG?r~-fPCSq|BZ2RړRF]FFs6[w0ى- W?t@ 6(@*!av,5xؽKU]@ۏ 9GԪre[{FXI'U b}>C[۰j&0L; #QiUSN e a%N58ʜkF"M *k/;RKx`8UC"ztF#[qœF>9j7`R/`E{b hB {~& 3)k~m&RXޠHmd5aV_vK*h=+]4ᡸ2'reɱ5/iR;&w[r֊ Y Epa2 8< 5@:}0_i^aͫ@q5d\vDV\u-H؃!} U\;1T2npW)>F;Sj,R-@.GgI~Y 8(413FJJE3zv@nCkkO=AE,nVϥ@21us}KJ mηFA{tHkxªlel4#p8+뭫Tc~!g JjhXv8Nĭ A{ sz5rtXman)u+RXٮ1 ؃,Kkoh1l3S0xfQuOtȴrJzrM.֐`)ͦn67Y0wSP{xZF˛3v|07\::$Y֘ZF)I`HA)OGL=Gg)2ljof#UK.#5KI!Is~'Njtl7JC eXS#Qfx mmdqù}93:)d2xմG5@;Wޢcw`3DBYOaՑq4f[[Xp8T)6Boo ƥsBQaٌoTt@Q$HCDȜk.XxŪ2sA?$ϦK2*׵"hi1VER:Vwӏ:g)*+۰X"`J v$pF=+U^X=1zǠ5Ʃ\͜34hdрksGpX#h1X6u%5'%9]=v8Jf<o,5 yh&b* D*'%XԀ /}XILT]F`] ƞRe;湿L=ZcҸXXUUeM: lf-gPDAZVW}[Z[s4 7A8z$P\mΊpYٻ@7cdŰi"B,@&it agNzZ]3ت:,r^x&!ǁ\KQZJ#UqV!ĘcTʮ@zuJU*V(,ֹׄ]SzZۥYS,J!0ܺ{'f9uf`;Od])ފfm.ȼR5:,_LVb#IZkU$RઢKAmp$Eko80& 0 :h4`r6-j9ĂxM:ﬓe!S/"U7c\GRZ,]7}jtraHxN$!"4xG[M`xB)#`!R^".6`LB`ŸO8ToK@ ; w*[ V] )-ĴqF{>R,_"t e#N- W16(s W{q@ĚxM;!})RV;*(ʈÌST\MP9ti 0> O(ձcLrI5kDcѐ} ɣY_>gq i8Q(!BDt~mL}D7E>1#VjX=W=ؕG=WCWDJ>Z2 T V!+TI덕Lm( }8'z$+V\J، ^1S.Mhɴu2o6imcjQX 4H#{)b.r/~R{5ѹP^䃶uA0JQSfjXMNpR[| :E%NVRMXHՈ88%X{oDk0%զT ĩк͛~''6RwI,c+a[FubסYmTUζEHN wE"RR)lXe.w^pXX[TN2zpjںյr}|E,J+eOTi"鶨Ȕ0rpk(өkِY ZrP0oV鷋؆9Hˉ,FAᵤz9V״Rhsh0'qCqY5Ǧ)xTa|R5NPF_ E)Reab3$&'YtEb:C&ǏcR`se9r5uG)v]auq&NT=[SiTm`Gga(9<uӷ}F_FKU8HMJ"5ĺ Ė9#RccM!hMiT:St28H/2UM\0#P WUrN:"s;+\+8[q=ق- \;hȻ3TQYN*P7zNtӸj|#^"w9ݴݛ(`[T9G Eg w&Jm*ZGkkCD%llJ>D܏5jRIgcrN版ܸAJ-b5Lx 3e6J7:[ Z Ld F,Ňlo)[Ec( kG4:IT*@1ԬȶN5&R\g1ƬX@ l읨S8AhpP-5Sl"! LUCǛQ?,,L>1̌g 8SiAs "]O@2n@X?j&zw>3sXWR"/ZA!DKȕyG M #F*O/*a T I/1݀kҥTwT**{ b32҃؊ J 9ݍܟǢa9Eq~[ͽE 6CS}=ff\v4"Vë`O u FQituiaMj_=JѪ:64cay%3()qXWõ&kmj շD)SU<%6#g /|0AB\ lk>l ꄾW^"^qdP'UNܽP "Ή-:#P)Pݔ \I k;~EIuGռ-):^ aU &լ荏Jj :%.l<ڪUTSk%0l )BaTf[m < {<`02U/hNvkh@rtl-jlzܒd 2!f=TEM:=]vؿH->< -Nz Diu`.vh$l55*_)pdI  FbnMb5 G,==w %3sxK \;swmE 4D[wNpSQ-*a:XlBx@_'yV-鉀A\CX' o}8-/I{xA&9jP5M69wUWfh4[n8PܓGw1 Ѐ2qU=zˋSr{}i $azȮmAÖfG)j0x*(0QK ڋ0Hʫ`7cA(IK(6, w^lkZv`4&]c/s6 .I~Lm  טl[ ")ЈGAy,EUVp^]/WP\Unv1VLCR8l8sGy;][1lj:5:Iŝ;= k\wGtw6cu#%^!@`'E U%rm@+%TZ#,Sov1b01n1|kTQQQZt; SSZL;_z{ Hw)is)'E)<w,:xj%/lwV$zE(fnƈ95+E#-؈YAlLht.՗c~+FCT:Hkf9$-E)n  $lb2zk_`wшkw|qڥZ}h"xbAenz9c,Βܞo=j4MZ-ieiN^-c1oMDN]'LcC_G0pMaqnA3TK{@= j/&-,/ L)}*TҥM*jM^!Q3&u%~C\}d ]U?R'(J7${H+jJ Mu= ṊL e: y# ^p);(NQɴi6Q{5ﴪPr!UYE"19sl2Y4$+:G 0aӶqAA)5JCg lH7Y29YGcn< s/mumxR.tki+e6#c,cs5 G bBsB:FYʲF7s oAdV蝈߲U&YnѸNCۍVqP#ѻc4>h#(FD*e-U AahW'Pn갴o, 7H Mΰ򗔾zp;-|S`^f0I8a2N^x)pY]xEkcNMÚN gcm8aLd+7“IQLcc6`%ș ^ T*K6 f,䛒w$r6t& r~Y-* 38x0؎\vQ+LVll@Rlm{>_w tx @ٲgCj Ij'6ev;y^HJq ('ayT[EQp1 o'U`v*":7aa3{2M&nk}ՠS"*viYohp@8Y  Vؗbz/ln(2S N1Ժ2:hd:R`uA*9j}.dqkhm% ib; "2xm}bAp?k:Gs (oD =j@AJOM@# 57 :XV91($#w }Lb ās{F˒LaA[&`0/n,Lp⧈ m}e60Pnx)kWO6AKyNN}3_h  7Gauᩃ}' :cxbo1wN:W= #褙f $p6ܝpcGO4o+pV#:uƆiX-+ZheY2@c@PoJפWqPQry85>f;n.04f=QW^=Gj\^QTfcTdOnܝ;DQmUÑoNvn tď/d:@#e}e1J*eSgfF2ל\`E wih [M5c>*RcQ)NmվU=D@nM<*T nrucE4[X\ n%K(Ilx4$j*Tܕ 5ͽ |s3$yhfzrTj;` F]wM&7w<٦ |m7b@_MVp N3 }3Yf4}YKGxČcZ&0hĹ$&XxXLcѦL.H6 sUnvؑ1Z95*|;Ӥٝ1ԓ%աJ<@ 6YPRě+zFͨ֠_+ 8ԲPTp1zcjFTVAh$ CjXv@V³>3Olln&0]MX߲gd6<1:Tb*`{`7P\o}DWȩOG9}_U;_G09xz5aλ^a8LӮa~&26 ]eu:)UU\AP ǮPTYQp=ܷi2 14JW΀qɒPܐAmKk0P8 -|e;=q.MR\JYwips |C+?$*9G s[R%W__m"ŬIPyZT|p)GA ]Zu} kYU;Y>CyPJ{ݯ bEUvʢn>'Jn  \g&ޫՈkT;~<~cG뙚3:hFK ܏X,z}}Yh^~<"R ŢK{DMp`{l5c #'67D;D 5=FΟ!kXv'h2M A˘[ZEΣfĴ[j![xiaERkҏҢQb 1 KZl@id+19R$*|W,Bqo(E"^˄eq}^nIZ2P{;LBMtc7ʵS`td̕kLܒs{}jb}*ß;F4m.() = '(47VkAT(MC2X":W.P,2xiޝD{!԰nAiPm\(b;9k+!lG2#3 MK ;0cs}/ DT*S{1S_Zl5VRB  uR~bqQjM;W+Ȝ4,H߾Y^Sru^j+]v^x -`j*-MC^Á"K,;d{f FJQsuFF_ ŽN1_oTDD0 8 8LtH&pX't8OKZ_7 }1Kf [:5oТluωJ*_5_헸>ɕn#枩o=fOTb>ioc,Ymm1G*}b>aS6U|C%V3S䋀·Kԭf&\:pgN0O endstream endobj 89 0 obj <>stream endstream endobj 90 0 obj <>/Filter/FlateDecode/Height 51/Intent/RelativeColorimetric/Length 5171/Metadata 89 0 R/Name/X/Subtype/Image/Type/XObject/Width 120>>stream Hԗ{PSWǫkUIB*SbEwZ] (>b+N}t>jeЩN8 $@!&pyC=q|ɏ E <cاGU*7s=uⳮ:d@d펢|ǻc:?)ҏ>{ŞW7mߣ>ZP0Ǐ]C>_DCCU\QmݺvmՊ2YSV%(#G_\2 ~JaVJnUȭ)ظbr z;av6`ռdq˫-9Y7V~A铽M6 <|Ț9 H)9QdRօ Ê͉a*QL (p,BH-jP$ֶWݜlrh~umf4ْ[R/TdoνLP%Mi˙ sFAITeEZr͍ͩO&%ـ ǎp#f]ZZؾ}4Y$;>=pW [.}d {hALF9;===ϛs_s1m-L8Em:)1SFD =<2KDpIŬDK |0BƆ2GdPh;vpa.EB Ej(*ZA{TPFQpQ]`oz~0Llyݚ?U#bJgqtZZet^ۑ#CHQxώޗGUxD:/<&K.`öKKKcr[~Ssv|UHT1T\PP_s8Ϡ E"C@ct8g֭=NV$lؘ75׈Eu]nޗmԗY-;.!!!2Xl#7V^r&Iuj0gX/(+Gx,cmS بip-"hD\\ 8*!JJ"$TFHjs6~I`b]=mO#9g=;w/mVEWy&SC{z73n@CNvA:q Z#'<޳3|klذAy۶mBp^`Ex>3AjZ$XḌg ΰn: ɵ4]55bη9,ӾgOpXFwd~QSZ;s-AƤVZZ*|Kܴ8[m6CBXBHsϖ7:l$0pv8dCNVڵxKObMyy"$Hs… a3yɜ(63aYV{Wʹj a8B8.7ڭp]- iV\DYN(X1/#dAp+ށ-|"pF9 G NusfN)9 87LŹ_Lrݺu/s(A{j qjV*@E)8h9K3d^3!L" YdNNK|^(hH9Ygk~=Q*@ Ife9/e2ismV_:se=rVd 4@7~IСB^}g$|ɞ4-pIOOr=o߾}J7nT?jlgR&K5]er,A-R-{C"J9ۡ  Ϳ¼&9Q]G6,M$RQܸ!Z$EPд8?y$##C ~$CT9oݺ5pٳU9?Z%r(87sb@D7ԇij8kb Z3+m`ZhwkvL`.@<&}Ν{ҥ撒DvEU8sW^^>gqp@ kk&Rts^+<)(,.۸H9&8w]K0D`d~Q.wxfnl,[5,aݢV[)r7}%zod b=5:t9>}5͟?_3--G/..GeGbqns'XY)gSFpokXO'ݙ)s*>ɘaeTCnzVx^XsSG)>%e (FIqO<?]F 22!E5:J-aqo7oqH~=Iq3M[``{aځ7A `eN#hu)F S +0Sߥ)ݡ7@HTZ$]OgA3 UFGvU#ͯ^6is*AyeeLGlg NwoWjTÔ1PW?,XG77Vz~TUzC'iSXۻni*!"6Pj&Wgt 6^myNV#}--vKUJX'*a`$/DU@&^ UHL58HOܘ,ՠ&ׇF~h*В_|W(tXmZ?8x C?N=uqcVvG-lZ18lhvX!ÃZ@t@]瀪5 ޯ_Q h@ 4t! 9l` 4Q cmN8t> endobj 92 0 obj <> endobj 93 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC]/XObject<>>>/Rotate 0/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 94 0 obj [95 0 R 96 0 R] endobj 95 0 obj <>/Border[0 0 0]/H/N/Rect[80.08 34.6778 202.015 20.9058]/Subtype/Link/Type/Annot>> endobj 96 0 obj <>/Border[0 0 0]/H/N/Rect[361.8 268.884 437.951 252.384]/Subtype/Link/Type/Annot>> endobj 97 0 obj <>stream HUmoH_1m,W"TF9Sz6W&$/'@}gygVmDae|0m<OŢ.}p1xP%Dkud#GO ؁QG^YVB ́si[ػ6b2K^:#UsD^35sF=M"Մ+dDNPSsYZ0[" TcӢ3e:΋`dQd/aR&_#J'TƘr`vLEU4@vA^ΥklbMW6u;D0%Y(a QmL}v6~vwg9|N G:..`ҬXIG*T2DV]hiaZov4"0m l0pr(ܭ6{&? +s-Vp~gS[lΗ-´.֟~MchBoi7~Q ed C50GU2LUǢ][,!h1h> endobj 100 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDDo |x c9a !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?%7^n. p\. p\. p\. p\. p\. p\. p\. p\. p\. p\. p\. p\..X`?<׀`W&޼`H$ A H$ A H$ A H$ A H$ A H$ A H$ A H$ A H$ A H$ A H$ A H$ A 8 =8 p+ӀH<L 9&p& Z 0oGZ2%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ j%KP-BZ0Q7|>pl^=Xρ0, k'{t6ehJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z%hJЕ+BV Z=8 h6 { +0%k=xpO{'mpE0&9 ̽ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/B^ z%KЗ/G`0Ap[f0NWpS{| 90#of4v!M0 yB!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"ӁMWv L`殟_`g90#`kf0 `WKt].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt].Kt]z06{\v0 ].4]k90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;Ӂ]n4K%Iu*90#`k;sGaX `\괴 pq殗zKƒpUp390#o4v!;`\zB!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!D"B!`l{l5t:٫{l ?=xKv! S4v#{x,0]9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#NwL{ WUm3`=xςx ` %i/u0sW.T5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIU&MT5RjIUzpÁsW\ Wp/K=X.| {[`\5z ԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jLԙ3RfI5&jF\{\[^{\q/<Vx9p. 9p z yG#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r9G#r98,`8*ǀg>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = ڟ4i]GNECu=KMD%;6+a-4S86M;} @c endstream endobj 102 0 obj <> endobj 103 0 obj <> endobj 104 0 obj [0.0 0.0 0.0] endobj 105 0 obj <> endobj 106 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDDo ux b;a !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?Sz(=^0+`G^nI$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$]8 :pv8Ӏ=ps% {:Mb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)pmgF/(>vp6^:+0Xy#8<S6`Z[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKbΜv> pWp[GxvK:+<`r7.n_~ :;`kfc0 `p.zBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBqfXnpqx;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`k9Ҝ < Nx*pq\n[W;`9lr'F\;7p:sw 7q*3;`pog/l9\Gx*,N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N'q8N's`Lq/'87q8/~ `/:_:+<``(pKf7zܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7*nTܩSrMʛ7z`l]L]` 8LUxx):w`/'>(pKG0qinWz\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫW*U\UrUʫWt8:sw8^ *S`.=p^;1G{೹`}ʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrEʋ*.T\QrLp],`|] t/Gz Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&^t`8Ӏ.U?1SzDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDbLTG? endstream endobj 107 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = ҟӴ Gz@WkH/ `(ioLL=mB[v  endstream endobj 108 0 obj <> endobj 109 0 obj <> endobj 110 0 obj [0.0 0.0 0.0] endobj 111 0 obj <> endobj 112 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDDo xx b;a !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?Sz(=^`WSx $I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$n<8=pS%lr֚5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SXMb5k)SX06 |vGo+ 9`W_`&*GqW{x7tspmgW)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-[)lRإKb-p6LKv8)1GkKq9Wsx 7>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/26300042W0B##s=S#K= #C3s#3=KH!9K3@%+ /? endstream endobj 114 0 obj <> endobj 115 0 obj <> endobj 116 0 obj <> endobj 117 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ U endstream endobj 118 0 obj <> endobj 119 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ U endstream endobj 120 0 obj <> endobj 121 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ U endstream endobj 122 0 obj <>stream 8 8 8 8 80 OLYMPUS DIGITAL CAMERA endstream endobj 123 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD492"   o!1AQa"q2Br#$%34RbcsCTdt &'()*56789:DEFGHIJSUVWXYZefghijuvwxyz!1AQaq"b #$%&'()*23456789:BCDEFGHIJRSTUVWXYZcdefghijrstuvwxyz ?W$B`YY!*b%BYYY! Vb!*`!fB`%Y%YYYY!Y!YX!A!*b!*b!*b!*b!YX!AX!Y$JJJBUB`*b!*b!*b!YDYX9"%BD%B,D%BвW$BTJ!Ya"T!fB``YY! Vb!*b%B`!B`%YYYY!!Y!Y!*E!YYf"!Y!YDYDYYYYY!B`*b!*b!*b!YDYDY`!` fBgѶV"a"T!fBUJP!Yf"T!fB`!fJJP!Yf"!*!*`!`B`!aB!fBUJBUJB`%Y%Y!fB`!fB`!f"f"f"f"f"f"!YJJB`*b!*b!YDYҸV"T!fBUJP!Y"fB`!fJJJ!!U')ځr~ϯbE'Q$k -hlvbmIV ` ieU6 QI"0 P! 0B! B! 0B! 0B%H%BD%BD! 0B! B! 0B! 0H 1   1 1,B,BT,BT0B P PB,,BӼ*Bf""fB`%YYY! Vb!*A /6hۇzgtDdwy{iR%glG5G){R33JQcAaVZڕCl0 SiTc{Iwį V_*<=4JtiQ,Zb38/?e=@k9InݪyY}b,gT@104T&F}08|;F>ӒB1KMcO-n'My,xNc:U,ٳ4{v&ff!؝G4MorDQ֯N3 LƑ _ n$0: :ٷ ٘D%'!*b!Yf"f"`"a"f"""!*!*E!*E!Y!YJJJJJfB*!*b!*b!YYY`!fBgԾ!X!*b!*`!fJJPP!Y͓Z.w&bV~*6 L;ͻ1ѡڜ^6է2 t $#6Х'Sut0*=RL3E77G 'T6fa]K{@q*iv. H$JO]{2N*<8q'O↗~ŬPژt=IΦ+1تꄐ=O-mwg[TpM0Z5&&X]iE7I3aK$Cs l]/}w̛OhSxZ؆ST$K:h<8 u*3M0{^X[4FӡhŊjU5 밑!';Wi Yck9&hOp9^o 9SĸtƳ\It44Ă5n7pO]XU'ؐatڍg;Zj634x BڮskP+aK7&Vol1ҭc) 5Φ̠/ o{Z6^HаmV_/X`F(Ãq"<Ҩ9=uC6쥥$k-|>&a,"R,tڒ7+qkCs7YV{MŎ!=xFUii1|CԄp:-~:5J’$yco-wa0h;C)Q!*!*!,!f"`"T!a"`"f"a"f"`"f"f"f"Y!XDXHEXY!fB*b!*!*E!YYY*b!*gBT+ P! 0BT,D%BD洸7RR#{BtH8VXU5,yʯF>[6leư9汰t"6nL!9f"!Y!Y!Y!YYJJJJfB`*b!*"f"f"YDEY`!f"f"!YBT+! 0B!*D%BDB}1>:gka,XUq (h|QgX'fFֵfF) `ȅ˸64)n^'uis+\8yRp_n7ֻU h4gPKvqIiZs<8"/1kmL+qGJSCL^ɫJ6Z-8^7Z*akL<pL_S`lztƓdpE<g9Ч-D{H?֪SPNAqUծʮk@F1Ŷ fm AZ6JCL8JeNwqUmWH $ `0ҥвqx*ۭOҌ p^Ai-m♂U[iwI>9 .)D=Pp͆v˪9D6 sr9VVpykE0ʾvfb~[xM-H{Y5ykK[T0` -JN3rM3|K  ;|`lG՘iTمF!!朤E+|P"q}x&70swlH(ej4K 1#W 50Q*8A;C؞ͪơfrXރrHy\ɥ0ԢrZ:F3V fyDfAѪkU1DHr)HAi;۸&9(Ĭ5GF9dw yNcca)``ҵ6Eet^ b(ЭW{X% е7 _|cX>-f -8$y}Kڕvn!s\ޏk ;Њ+Sup"۵].>*8Zַ+Z@X i㧡Gi@Icr#bc:V,&-'xÝwJI%<8!UIQQ xZ1IV2 A7wIg4wϩYÖϨj6LLC:l>hZY]r VN\j|ǰ.ko1ޗjGzKƏF >[:%넅1Ӈsl˃q7 qjAoR{evB`p DiEf; bä_!߱?,C}J0Z3|Lh:sT`g-x&M`&.L><ᩱSUka2d8iyqBϭnЫHTx`5NYeOigωck΍c0mQHcfs"D蟌oHv Hz>űŲ:<6a3e- Jjz΀WZFʢhl \X^ jtxj.`VNf[{f`Ȩv:(++'bi0ug4_жKdK\Ee Ohl4*`7%mzq7d$b*akAY+41=M<װeo: fޓtfjt6!5dxl-:w 'P񝣱ͺ|i%Ņ,wzbLjZjC)bUnXXn F"$b @\cqX؎O^W7j8 F#@e}\ލ$ KDebvf5t+ai5ApU5mC e* sNgu0ZH6k#5Y5*Vc$<"5&ئm+am%OnvfӪ Yﶼ kШqWG@H3c;DwZoUO􏣨:t+WN)/{p HnQ%*旓L@ l8Zw`F`Z8jUەk̬"p0;V5 \7/X Aׯ0u7w-.ka:Mk)Z19jէн fE ~øn+kkխS+[~MF8ևZ]-J ' I$4MϔC )^^ %F 598oE31C9q&s^ =IJ ;ĦW_Ju84l!=oԗ:mX) &ԛFkU<5ɸP+`DͳLִH }()uR3}w&AyjeJRUZG>t5Dڵ$s֝BӤ B%wr.KNg7;͚z ZO-X! #E*E@tX\GUA&Ch^Se&os*;mGt$fJav u7r3^:ZםIl!ӫyxp&\ANgM2ehck7O5sA62<ܐD-&)9%iB,D%T`UW}\n: FzX wx =KrFJfm`.nw{K%) QI9Zd^D!`8ֆ26դo\-Fjb3T%B D%H! 0B P PBD%BD%B,D%.?BJ  0BBT,A%*d.ae<@|;H#L2Mq2ʝ\jE؂[QNjlq󌫝;{]{s YsوADX7(ZC2,D)I}1vXvY!{ PMFdM$xp`e9c#? Ѕzs]`H f2kU RBָ{h}F Vq H4@rXlwо#ʱFH@8s|#Q82)Ұ7B 0:YM􋠘BZ]zޥ2LCn)M7\+N ڍHIBS O-=an3؛b~Q9>мߔ>Ť=6RZd.u5`Ni7epx޹;s֌?JIΕtY{C&1 QjchUF"CFաQ =ʓkԭaIOcMG47HZ6:uy59Os㰮]Ri[%fs˭cܰV\#`[jpcHӂ}<KNYsޗ-3=#]_5AZm+a~Ak`q{ E~{: !4[R [1lU-8YAcz׺f#*D4|ob1z>罳G+&1W㰵39\ޕԋDKNSDbZwμVxvCC(qVn*e t QÿgէNSN50|~MMz"eTczG&'Եk l Qns M4\1. /jc:^&"3~h F7fsTϞ&*}ZŰhW_Js>I_~(= 9SnWѭ>'&μ{T8{J~Xhpk}AVG.g\v-ZpbiՀuCn[Vff՛V4OE~t35ňL,v'im'ЩN{Ap1zڸ9ՠtd#6bi"nM@41ւᕴw1IPT##an%lrDBl%|n/pKBkܒ,hp2-em ʭ˘8$LO0k\4Hl BypZi147f֦jatAY$NV0 TѨkU\ aiv YkJ`@hV*6qJai'(c[.@L;Ќs+_B YnFXno3ϒbf [֬n̮fj^\\.)k>$2KZ vT !{&w+#fEk8[#N,Ke3m8) õ#6iXث8cW#VI8oϳ&? _ PKjnuU4Mjv\dH"~a X` {]*SI=7oԑ"*B`!f f"f"f"DYYXBT* Q BBT,KB, m2E%Wep q5rI1.ԩv冫;mٕbOhۓ28#8lf\ej079Ovzb#E!)mMNA@FCi{2A )V?R4 -#*OX}ed23Z #}Լ;FuᏙzd?#tn/\¾%_@GI.YUh«M w$3olyޅOf6; #D؞I+4~b*U*b14\.:{G P 66Hf`*3U/5 soL'|1n2-L4XZ*XDPg/rX m VPӳ1Di=S7gQ Τ8kr 17 `qBT͞ _c\[hly.%U`وӧPqfFVjV,ƪ+V/lC]&cC$gT~- 89٦iI7 ێs>fo7IvMZ=m]Ŭ3Q.Fݤz,ſHR總4ɿX}ELK&7k.{ Q])>٘@r؀%[-B5)4>Rp7&ntݠ '+UHO݉X)m,eaoRg`9_;vRNALu*7!tF,u3Ӑ iu-kd/»b48h- 4ug eq5ZX2^\{55jc30kwbjh J0i҃/'BLy=>konq`n<,!-1 = IB*;ON QۻJa.q .f O5iC+y|eĕsYϦ|(Sqck`bJbCOUֵHICKÙgax\ s7 R#i2+c_GofP{SJf "f"f"J!YBT*!*D%B D%B,B̊*0S'9Vq6>b6}y>8:(e?:ݍ5?:[M81Zƽ<@-ڣkI0{LCC"42QMɽ+N 䦝8@ceR{Ĩ'IrŶ6c*1yÃ~ұ[HNknr#(\x 3=J6TčŤɬ˓ SWij"5v湺Fv89OR&'NRٍidG0Nmʹ~֥fvns!u8lFWiCI3c!}(O NF#h݉Cuep{dyZ56v~$/Ѫ痜dmZRcxa/9hbӼ-$+u@|?ib"\-7kZqxZ^TSklB,OegfpqicHn0mkZC49׈MkQs77;Ks4 xV鏝7* 0ۜ:\A͊JX=ɍK+oiY|yլ-fmi2j4`n:B u1o/%Ѭ܊xKsB$8*-u3|L]Y5ڎ--p8{[WvZ!MwHBGrI[L, :4: ]FpNL N"ʘѕѨWb[KR1$91%jCGlN֚UCuH> ?R p$jVĒgiu/E[@ KA"wMhY/NvJWգ0MlhmVw=+vPŶ:8TtU洛&$CmJ5:,y)s]V(5J &f]: ӵL)~YI{,& 'в $WwfMh˃c;I"7J~Q`(.ѽͲà ;WWR, q*hsum3{H)MG=.+3Z8:|Y}F@!Yo{Ɯa,axrOmk`744Y э(̢B*>ꠚLRxiǴA !a.Ue Y5Uk]oҭ\+W;JY gY⳪4ə13SB\YJ?'UÉ0YVDjgiLf:- #Nyj!lH n?g70h껏"֢;(+l>:{HPm6A4uj6ǰơtcbU}4wĒxJk0uXlG߸+a j"qWu*8U0wN8FKmep%􅃸Ю BIp˼1qJNlXa!f"`"f"$J!EBL 1 0B%BD%B­9p9p$ * )ݤc S9M8Rgs+t-YהfVt֑fl7N\84.iΝÖY"rb! nzS507fqA^q$5D:N f@™ 726HÏP[)vbR'%@柳ZpIf`icvhZ9F .ၮuLh_LŦK8Zqji }J\|&%ϜsYb929X;TjI4l 1]MS1ʯV h+wV-J,ƨB­WMI1!0̜[p8$XJX6%\C!IChaTshT5Xڌk. 7VTs]sFxO[&ŧ5N$@X1~9siRzժm1Eif1lO)Y^`jk!4#;F ]8 !ĊTf$N,^#TYXs;+\߾}lXqk:! F,2j깠)|#N2kWaVw jq;V☪՚ILW7hP`S}:컡D"ɴ5{e $D *5v\L kIԩ9dֶz1;>Jm벵@=IYkuE=ħmH{AQF$cyV.TwEWd&m:}΢2N p#IG1sm>&O}mG艱Ӑ.,6DTVwB0V\76Cd4=YsZ)rc('(7q׹ C7iUS mX5ܷF+79z Hp epY\w2ZՑ־C3czK^涖l,bpqbEH2 : W\W6W@{6`(k\m3&n;ep&z/{#w5q80ߚ gKAֈ+VX'@4t8Oٯb=z8-c_Bm2b01IBQcp.GL1<2-[h᩵Mbirduu-H;3\W΍\u:.c![YE7Su:Ecەf o3}ˤ[ԖLEu 1GOa_,5Ɂ9Gĥİh~ 5ZIµ:$xwGBq-1NdɨoP |O^M8֛ Lz NIجlШ8w-ch7f!:ZSO,J ؊e;8-|)5#Ɠ}IkP]* jx1kScJIyԓwEaYl^(<^$Ө-v3 =kYLCM3ka6;5EsGzcap@JuM;ǩi}f(@H;IBDEYY!fBBT* P! 0BBT,BT,Uф8<+tDQ81m)Xb,lI' Qf牅%&~8_&-\ǐKo1rDc0,zj u2CVw^Q&J ?$۲{3j"b՛F:@Hq@ &J7D\MەdF3sZڄ99ILgSe 8!1:ر䆑-1"AI[gk_DK'b!єVz ia@HesHx;I~p).D{f<|2}J%x |@tX T8r&J퀩WeV,E*e^-,a >m֫ALT90Sfj<pk2bR/ht*cQ#4:Kehۆ(^]K1OBbJƛM2A|7`CRq5sNN&&Xep*t7%u h[X\#"/PJmFm'Өi`Km3nzoP 4%E`RS*{geᐍmfB n,50:Le]F i[ `06:L1mSĶN(8Th%CA2,h{A$:I79+m x6E Nd#)#u U.iCN]N2J-CuhRUSTkjD9̶PJSOZi[h胘i'$(YΫN/'֝sSkUQs "~\c OXEFͪ @{CId\ I[,e$Ȗuցc%_'i٘aah{Qm.|':ULkxhIެbrVIUfH4cxZ1l$mc3I6c+z$aiQ@ܱ 2AR8lG<Ө͡!n"%w#c Vl31Oxi[f+Y U&Iu7` MC64bL#!Rk:aCfnSp㈧onOs\v t鋂7b L.qTcs܌h_.Vِ* |`V;z^uq5M5jt|m,;GUi,vqԔ֤k4q%0*(j:ԅ÷ɤ<<|&QrQ8RvYia)* %H3ƫUN4u)`K܉[iLFkTR&i{V4+I+fUٸzc}2*5hsmD2ū=L\I*KGiQ-xD$J4k+ Gbwj@[~G{ijKcyLhr^96]Rw>QY3Qu _oWژ>Y !fq\GXrp=YwYA@#E#FV? H#;Xii":?eNUÁt.WW_ha0xLEJ;(st*}7N=^yv\I G*P}6+CNGⰬP} ZZw8 _ίF1=WKsť`3i)} \av.wkhZnM7bVf`%M,#> 0 [f r,PzJ$RaIhz̈Q摾.=&~POk8Q7iG,q-;Es0ݵbQDCChW5&&Kwhc&ZKƂM3a`gUQn;5acq¤^:. ai76jJr*9Cs%QQea Mv1!YqV HY5R/mrApշh ?Kxu*LAsCZgPSʘ1R! UWl K6{*{vkD\~vwq-1qF\I&: N&7G%4.7 _z;c\Nnԅ)n"Ɩ+]M3akSVʆE(&\ Z~ú]#uC"s{0t1}JxTsi9]4V %Rt$^ #p5+=ƫY l8d{׍~Ť8 *emtihvǨ-3ꋰZ,M,eWwϠUk37m-p'+8RJ5PY;6li>QWt%qÉwAu3D:saffMJ Y5դ__֋KZEa>1aLh6iV6=7" nug2osKih&`Wim:D+V \4eaƩXbODZ^I}&9 19P98G!TqԤLnjzoS& plUl~aWg%su]A8YNmx^rAS?;7oGQrf:Ĥ/qxjU5s'ZW4hS9k5 +afu 3TXtCjA KvFg8ZiaQذeKAX 踼RT:ghv-;Lv;gm {À^"p6Й+ѥc쭒2t'\MLJz{1ܯSkZo"Dvf1-H9(谸==tZ_#@. sy+#db yDvl#$9nq|Jf։7ݍhq7֤vg9ݍ>L;g 4eC*a[y)@iI.KQhf:O wDfwhva4{xԺַv=IQX5 aӦƺ34hjp;]%Эm<Z s5)sj2Rx`ǺZ>'T|z|3dx#z١ZM٩Nx;\"FV}<-Z bG[ |M+");# ^5:ΦJ!?"j^K:PѢK gT$d4 {7&CW7Ce$H HǚI1bbD $—);ҠܜhBiX͔色UXeJP7ˈ耈9]fGj*9b H<~[7w,9v+.𒐹)ԇZ9` |K)"fը/t.xzS*k}Fcܴ #w@h'A&S]䷱5HZTU=Fӡ#\eD٠hCVP Ľ/0Av8Œ.YoJj}Bfڔ|"} @1hѕ[>}M7 'SB֬N }+HsMѼ[41XA-k:vÚioSjfbQاEFS~o%ӤѧNj鵦h#T{3tu;ۥ&' ~KTaƶ Tx%^G46p{nb`lavG REtni1jVA,k*>n7r s\d6+x=B>)Ejl2K5)P<]f*PՠYit+ cl23I;}knٵ=8a[Ch `'6 z` orX|X튚wff!sQj˴JqYse:{'1f ;l.BM)vqunL|ǓPE+KЫ/P<eX=)/deJm&_g71pHFmD"/eCzwR"3pgVLtkH޲| @tXpRwGNV $Fz29eK;FkJ-<4rKFZ l^a5~JfG0\XY\ pӬNB\[d>"Z=ON]k\MSX 3ߢC)cEͩ9hz<ИMYZ:y!>I[զQΩ7gz0񎣘Sl:X[h j \>b@'aԎ!havmL z2T{Tjz TNYhqxSa=^Ԏ}f̧\ƶkd9ޫmL>+KX[AeėJFg: q0[ӭԻS `fz1Z&qi[VOiŲs0U+ejJPʬI*G-ˎ">xP=xTpETDMVT63nRjluNZ0&i@C!Ç"ױh4VZLuMi E`,]-\ץ1 . =éPUsIQ_hpv1c,VmppBa"$  6|Jƚ:&uVDo3OY+l4N[7,tMfc$@N2%Þ: 4&ÊV։*=/pht4*''漇Zi :൛U(rATTiqs:I*UH씴ڬnvZ!*-+UD#K*EV,٪ׅ'TZqH8qszc,xc@ kCA.&Z#]݉8D7fxHHJxRuP\ 3BSѸhY*.肕 12eA>}ʒ ԣJ*ΧUiH U׸"ĵE`E_%awĎCoz>V՛96ޕLX35cf;]sj51Ozp4isԪQETe{%iEckFnէ /dԱo`Y60CMw{V ;pqgDϠ(zy%j5e!H^ismbM!A>/R Hvd,g=s\:,Sxg7jt;\HO]=j}BYI6whVX3vH`7h"RFv$-z8El;k8ݵC)@&5Y9nEJC5h2 i-T{~yh3m6:k$+M8J棥ĺnF M6l AƷMėd.2JHt_9+gt)U'!t1 GI`֥C!$Mʇ.1:Q  BFkŬ!_q~Ft!ϩR`DNgqn*TZ 6 @'SV~ˬ?gWkZp;ޕSkbhT`;'Fp!uxW-i,GŨۚ/[naԢ>W5t=̝d* %F~ *7L[Ԩ/ Msz^!Bel ZG3Re F X|:ε>.G@N%0 &;B1{&V& 4Tفm N*V`\LZ9(ҫd1L0M]8Tj9g,>'cajm X*01kMJlG+W\Ik-c0n 5Ferbqa횸5r6ip>RPth$8s`U]lfv3;N"ߪ ga_RFV1p ˷kx[$siOVo"2h{ ▛Rc0:\ q1)bP`FPپn* OOeVt,MV˹lu,5RTm I]uK24&ѣtl{`ƂxtKI"җ|33U4C4417u+.oͨ;t<9h7\0a۵:9Ž[ P4}Ow)"nPg ϼ[^ ei$dGi<-74ѠLi-wѺ9H)4=_?(nfr+>naԩ34;#DuC6"@To /d@>uzKg6nAúd&oֵOixVl}ڙ4ll(YYIOٿNJVikO{ϒ9W >5A{{A/?mg 4;&#,an;dVsjч'٫*`NdcZ+TV5:'Wc9-zaAt: ~i;'g<5~PzP3kRoDŤȐ=d+fΡi.cQ*7o~_N03``Z긏Rقu)`YY TF-k0HRnw޲J%l7J0K>2WHلTvLA+9;U 4?K\";89>9UDٹϝ1*׎Wҥx`qD5L4ͣ mW7`81 6ҥYmJ "L * bR%x!_hJ;f{ XڡlHc@%'Z*^OH.H­Jpka )kgƘi(]]gqt18'0[Q;ċ7NKdz=ZuC` [u܃tX'&OTep:. zT6&atUzanmVvRCg鏂U_|];KXF9E՚\@4UD/\@OpZ'+A:(-Fҿ)F&$T{]}w*bjl<48hi͚I$Gb&+tBU<1*:u@:zUPuy ZZچ) 3j#,8NƤ\Pa5icjQ\潦m@fwUxGew;|a3.r,p(8ݞ ^!֊OcZ @q#~Ufڣ]p&$k-֥Z\KI2IZ 7kelŮiC[*u6837֫Uٻ;8:%[]W<>* k$-o _j~;fc k\tÀ1n;b6 S UэtkӦKYRVVO6/j;g&",BD%B6Z*9Aqf&!v ,u0ʄ\$qbV~' #$zh3d>А@=W^ᶖsrذ@u7r\;WS+rT)/ӯQsM0:Ǭ.gLA^BEFIK# nR>`Z9&x{k4̜9ѦLI"[Z aPylj4̘hS);0.s:9?B,>Q~$ +7-T80^HiyOB XI)ٚ2^/ Gmu\LCtZTEhc"F7 \͒rƧr dOeG#=]$BIܔDzRA=Y0D NlR>@X3>@ۓ*?3i%FFIFh$AQۣ8ė]E7T. .D!73MY37e4Z<5BKИ Sa5]/F n̩Xh. Mojago@Ť͘bmw~t>H2rYlvwBNUi߯~gp'ՑBp XuVlFg}{CCDuԎկjFeAx' +HD#E)`u׊iswnBMC boLyGti3H 7SڹZ;(N)bis-=V"WҪf,=!y9-:[sҊp`#4^[].h.|D{49՚L;W7F6}]Zԡ]{Դﲽ_qVJDn{ZcQqTl'!Z`"s5 ٘GG\H{s2b-7 G·Ie$ nW?ST-G]aO4{z$[rC Z0};F`1D5vaQւ:oB񌚍|Nq/pp yVc*XC!\m]Lj멟Zm,*H3Z}EZN39(6Ae9ܓeP:G 4@vNnijxI[x+TU1i)3%2K@9bxBq{>Z^'0uԡkt`nþdĸFV*b6}l#0Vm:N/a2xd Φ)/s,Aε}l1TS!L;8 %_l܈k[5ia>D3IϥX́i;vc]TP.cTl{MڿJlgcxsu}Qv0ḶLk0:TPYRj4un&c]_MOµxc&Cd3`~;<%JQL :HWl0 0Zrm.0OVZmWU/4 smGmU-k0`J 5+Q5vZvඇm[xk 74D_ܺ @hфq,$aܐɶ6YؗN RE'par[]ϧnVx5'p"{ Fa٫]4-mh5FvV}*O,p$8]# Bө)hkФZ&}M&Z!0[W[+qX27;hb~+[^)9f-:݋UKZp-"g}͛C 4jS%HaTNR},F #0fWs>+ia39:g,xJk֥Ni{Z3M(^St3nZWD> 8R^w :ZLf1(im`y?jUagq# TMߕ-&]FVd<{Ɉ"ȏX2ZDuG a ƇARᄹ;Ǣ}AX1@sL}TgrS}`N\*OXoXoLF!37G "h]@NO315c0]hNcdMUCf;7̹ZZ߹UG[ gVZ{RI WU0g|J33/<޵BAB%9#1Z!3:;Vj~$oJ7q=:l~bFTk2hA h aU{DZ4skv3۪x{1Rr"&5e<*C~$}qDfqHqř *R\h/2OO,I d-CEk8*ΦFS xs-hO$3NX PmU'L=^zP*'Z?\ׄ́IL.pqu܀#p=$>d9Ѥ:f)P[tu~dtU Q8i7@cj5ITNi'&Uן(Q#-Z{j<̩e@׆b#rϜ0Oe3!CT5 K7nSsV%!m:p+^ @$HKKna*S4ӫL6Y:Bas-@:NsװslwH͸jݯaYNK9j]Oa '3r"HQLnϥl~"'#F`dCA.k(Y3hⱝ M*$7$TjGCrX12Al1eK1cfUuNd]' ^*ŚYLANUz}+vP&dIĹZZL8  1,m_rzKacڨ? }:9Mc#)w0Sc9fomD-wө *m8l> iʠP= J "PۻCiq!ΣL~0 e㤣[ *iYFCnb =%XHa߭O+vws\N3(x"X57\{0a*P{5Lϝj;QsF\hء8PE1N'dհ߾gs?<ai28fi¸b紋p51X)5:j_+$TUcR4>n 7tA6ܷLPR4hpND@nq5w8iSn۬Vc%Nl?q[ ֫?L9K_&{Z\zJiג.2v+ެMB\4p$9شMYIILOlHna/iWÈvݺTkI$,u<Ԭ OK0۳YQ:\/ `&`SígEm0'&9ˠ]A\2HwIK59KHs`H'IRe 9s1nUK괐~eP{*\` "kɉmfɘc1)#Y Z$m H~{6t՜Aq~l֟TR+UH4@Pb=2]؊l : KtC,X@\RI*U4yW*5 EóH"ZnKI3FGmMOk 7(ݚ $^qSg`y8"W`xJFoF[¦"CCɻٓ:α2*ܺnZ ͠",ˋ?zfMLP)'0QO@(VH̬?#Bqa`]Cj΄vǜ;Ϫ0 ܚͨw4R'j4:%Xm g 3bĬ %ճEDonSeqvǬHSx1k-=JTq{mPògǺs &{;bCm#6N`LaF֌L3ⓤf9>ոvV q'̑<I\xk 8jzX-}_#@tM"&. 0! 0[L:gIfv$j.2dkXdm1ݺRL \jr`::O=e]+>/ O^.5]bM&fZ>4Cý6ڂ8#Yk`G$jz[|yC)+]R}v"\F/{(TԶsm. *A f[Ha42Y{=թ4b6Ʊ'@2ӼhG% W+hR`T\ֈQnq%3GI{1sK}uMܤ(էcj8I}C+B F.c#c5r4LfetZPyܸfLSXM'y< n!4EG4 en mEJyI`k"׻frTk ѭJFcS3`Z/ 5FFmkⰭK"g޵KC )dVr.u7$1HN4ir4@-z?јHNSO/4~3jjտc;% %1L!RP[K_e:d'ڲ'oj17i">3LCWch5gr-AOvv*XvzZj`uv-}L=Im*ն1S~ᅬ9*R oPcsxpqFlEWI԰c5ges 9YG ڔۅUasjf.0+#ORڸ+:*Uak\/j((jmSߕ2 餏'6LKqt% #} +945ܭƁW]ً6֤c41whqG\?4"*%Æ 3N ˲V+a";aٯ_RD Mn\{oHb#+|JnoR u" L5N9@sD1UmP c0V}v{+in* N@&X2Ҩ6+ڴEh1B5=HMê]IbͶJDn6=K'foOBiCLWz(,q:30CJCp9{ 3U&gdcrdng mT-XX`@'.iaI F]mKs^Eh7A[%g%$1E̐Z3ܓǍL fPq-c.ly2ہ:R0a:B BaXcSj&£srw&Mz5 :nշM*/b#ۈ/qstH[lMϽf7Mfx&sW+sxNI-P c$j6 FUq63RA9,36ḼlZ\Z]}Ҥyԓ1c5:6)) EpD󴞒a)\gAֶzB\ic[8Q64ƨDb 9H@;>Q,|Q5zڂnkZX*9" ̡1]L]͖ζh 7,f7H05P ゅxƇ5ČEH! fs:8k!H"cy4A&4˳x`Qb\"sZHͻ! l\֎N+T, 6,`rfckH;ܮA}1=F:DT-1TOk1`ͤE-$c%J`$LO֝[=GO%d6Wz7=tXk'z-Ӄ1FƼd 2 hh }B iHj\6В头˱Ws:ƖVT-81&sH U4ӊCz k}H ֿj.H1ylGX$9D90{}Jˆ0,8'fw#9:d `N#k7 vP)e. $r/XCrk`;l5q&7A0Md1hEixL`( u { c`oI!+ /q۷͓S$N65\ .$pܛL47&"cy!aĝd9L IūQťĂkk!sS:hh{؊4'Lnܟ0U[{i$AkٹBxټ SyѪ"є/ڍ7߃^ Z a7;RREB)t&nӐhS09NHNkTk8lN1030.2x$Gt.:7PkX,Fx'uM98GsjA̢ޖ캑:'*](sIatmSc,ӤGG`b*4ǥCU̾RtVᝈH̉ ζ1{pk*nttq1sREa<[7K+fhҫ9)1V'KLsLr:v~`{PH.nO5fï]ʌB̚tJ nS{I! uXjNAM6b{:DcOkA#rk8ESl@E ke>Ҧ~tqT:MEف4kB#V=xV7N#Mb$khtALvZx C.%l?)0FobֱR K+r ]U{0bIW`^й7.%8nM/i4d3Ne Chg{M%Dl *jڕӠLEk14O⻱TC,I9m_?*݅a[ϖ!n@P;y4qTkX sLZ`irq5}0ސeh J\]4ID`~vdz,u>)=z+\c0Zu.:l8DsIgYQezuG+h֝3KU|Eh/-r0F}e4#ANYŽ k/Nel-AA1& :gax;ft2`{R &Ƌ-M38:QgҚ^#(ӀUBщ:GM a#RԦX>; KJRv4یWŕcFM&t DFg0=  XQC.X 0%51.=up2׽5M2&*ڈV}XGJϫ ~FƏs%B|$sH_䓤nJ.Ay}j(Iyh= ^OZA,$ $u %j86/;o'nV}R4gz7(.oOxq$LnAn.tj[RSt2, 2kx{\4q.&*}LS)8LHKSUT5eۉ*&:֓Y?#C̆"ñ.2-z i]`MpQ5@'B#h`13\ܶ@^3$< BK$ ~$ xH:)cЉZPCE%5C.!BxY8lhHbbwg9]12HT+c >XXYE(1HIHk@N2: ?xgVsT.7ȘN}3pfB C&H Qch+\U 9ɂ)RN. #4+L>xk4q=s 1H3[`DM%..8ؐYH2w8u.N_ FT -h&no4 c!nZFCab'؆Ii"%g{zWe˪6sZ#ʝDL1{/h6?U6P4095A#ϠVc+AN꒭JhͧWj7,a]y$̨A 4{Rvw[&uFd9z0C|T5 K4 zI֏&1<=j,)͈Eï&F\֚λr͍ y^:uKiItnJ ](h09ϩF0Xؤ., ઞ-ތ-&sA` %Lqr,Hm&6M5%t{/g _"|k?fkzڸKz 6*U_Uqsn7Y :{3B,!;˽6^sSmS^Hܽj[f9/=Hܖq4jV84:6#:WEq:}5L޴ ZJ4^ iPRSڋw jNn䛓F&Ye@Noږ% (vy2޵ghVR^f Е)H*,eF6 7]ir6+::cÜ2t(3'E2Amz̠Ҩ9{s6Ca+w†QG|xpOzYKQg05y !\DEUzޫGd fph-vW5..T쇴z)LL:OCMlXJȀLKU*~zsԆ : k+nיh~ŭ-1i xj# )ELfVX,[ay, R׃hVKqp{R01- YaT4_PaK{WEadsČ5UËNfNaب\I&6ܤyC@PpQq.tƟ{y-.LmQvTHq$Y˾jeytP V$MB31F?ld1g[{-  Ja%;np&#z8󬣥7MzrioiHoD#&-7dL<)PGQՆ'ut>_Qōit`$)C[}hřUb,0Z/'t DlSxJ"*mrwGiGJ!XMoo|h7>5b?U:LG귯[HЍl.FC\p7uW(gMUvf53Z;Tu&&ˬ):FFc{, ts;3l`Y5AW+KHy*BȞP㕺߲WG\u"$Y S1NF@d]%-; ;,x=1-1Z=61-ti|EXqA]͒0J 9a-2pYYiK\"3HԸYS%*JI`!Pe)\h#+~qP=auFegYt@{ @lV!i ͼM1% 0 )!T=h 'ù ذ$#3BE;FԢec:){A#H犒q36-FFʍ[ʅk:s\CZ%2I#ZA XPSVn2&a).m}]]u}EVxG] LX".RCH"JRBƾZH @XZYZL+g(isFbQMdĒfTwgLAf5g(|\v#p AouRA*VFєɆzJ*ReJe֝ 7%C^I"3Aޖpڥ I7:YMP hk2zY+V $A!4_{RX=f\AL[rI{hf%>7:J:Z0'1.tŠh}*48Gtn)ϩM!:DF  ;?P,*  ^ּn w!8qض ضj,NwZF%}X}t޼ƪ:$+DЭߐz Bq cCN#F܃x]_ٝ# }J s[YeguJ#5GRjy/kSH5EZ pL`h}`GjY'IDJy',е _mǑ+e0}#kF$!!܃C pJ%܋)77 H4^lXuQsr}nT} ˜ٛI٣tY@6e 7ƓTu~ ha4K+`I?8" bdC$qܳRtJئ1xOh;5 @q]ٳf+3)Ú?pgݑ4~ϻ#YjC~(œ÷Zސ8bT轠 On M4\0Y)X[s.<^ª8hvZb 4A>դTL-77F4ەqQͩe$[<i.!J2-}5IinL{pIIR@ ^ $jW?+]ng S)mFCn 7 BoOI9LO5 qY ET%:<$T).bӕÊeuIk̘mZ,MAqp$N-G8 質bMj0 Mv!i 'F,U1.-1bI+DPmfwD H_Ы7zv@jC{O-1W4Qkc 1{.',];Vטt@HW( sl uF2sXڒ92Gn h6Iޢӻ(5Z\S)v:0UXBi'E w)T{%-WR>CIFXi@kOT`, DinoHmިɒ4·1!T㢤\Ks1ܺu+Z2a z%{<;Uˋ[;PubWc9s̶DiL9j4 97 UߌZ" "퐌#N\q])p)U\KI OiSTs H vQ3AkI`8`bcQH#-Γ[TxC9 tN,㚦R&tY8CQltDt6LNnF;tE"luN7deU-**,AjꑘA 0 Uq|CU-syĖg9dQ?Bl՜?|fXֻ",*4b8&"y8uOb:YD$fV$v%sR0&;҈M:EVff֦DÚI056]!ā I6[RX)ļvXt4R4\4XM`A0 ".SEevA{/;.504^5*ZD6;t(ԪJ.H"s@߼+-p:^i0,sɈ2'x0E^+D2RH$749M͍qXYSncI'Knj59yUt4-N̝]M|c5*1fe#v1tl q! Kw_Ϲ8 l8[EH IkS3$CNNEud .4@k6XwoFP ;-p:L$JilMsO\_ mOV; JZM\ᩈ0 򳌋--Rwe>Z4֘v BX2 >Vih-TⲨh KΈZ+LfU~GUk#~1:\0P]EN)2GH]0 W,,i9 h25Bl6f q)zp! V AlEB-T."c0pB55.JR V%ʤ<&Y-ڋB_Z#M֣"0w$Sjk"tFlP B6u(-A$D+QH#TdX]#ƙӁBPGJ nva"Aز=N)@7A-T}Ob:&7\l l)\Y,((n\Rĥh@ZSd]?(( `M iDpN-CF#DJI70 `Vfε7{`WRA'د5GjYf uBզPb4 v'qښrb.0rcO)%ide0;)2JcMSzR8M Jr=;R;{`/1 13 ?#{ʾ?;MA8\N*ۭB0S~j꧞l1GƉ VH2hNǵf$ N95ڢЊ$BY_hAiڰ ض,Bq fLLu+*S834LeUVZ)9 "0A憀^rm{jdhvBږCr!:V,$؛2AUI슀u] BG\e"qks%524@e&ZjCi! ILGNb].$+YU|A"`A )I$@ K"Vb{{)dÛ$0l.QmcQHcmɤRH"04pZVU`{E I9q•' Opx@FJ3N:y$\RƒE"Z"&n(ŝx|[O{֜c cyXT9\潍E;/].A0\N%^@KfÍLg-Ω*ƛ9KLi)Hw;^ s3'\\-8ׇ\`FH]$ Ȭ-:3<'U{Zx-Lw CL`0F;D'2@;D"I"C$ل4rU͗fI/VMPĉLoNφ{K^̕ÚA])1uR)-w٘ʘř-1qEV"w9X fk1&[g~T1ީxN2&!w#1")PmD CY2^Va 2Dɛbq#BJ^ZkfJ!X?DnRwOſ40@pcL*DF$i:773Dd;|Q)""SC8k# ]׷b Wi9Df"*IAVӶnepޤq2G}I4fCʙF4)5;Y~mI׹6𦘙@uO,ޕ131]c @7p8쐍oG|%E֠UDc30 $ʰN4B52J )<CPBZf)D*Ѥ&w7(;P)CI;sRg{\$B"t7NFW'f jD5PmaŴH@ 5U R m""P h7J;܄D {MU323OXOjSAapQwKj)bj:TcN5=Ul;(Ϋզn<׀6F#DB8ʗOJͅF8ze=mHh5mCҎӥk4mVk 7r_r4SuZk$4*gnL`wDBJv29_x?QclfKKuiCq2:BL伃ms1FGĎa$C5CiR2Ƚ e/@qKsG3Q=śS}dke1uTLv:c*@_ 5g7%JN-p;i8|NJ \CNVp\dN=jY S^'JIt RBQ }]СB,K&=`>񿊩Z? ˆc|ʧ`>Z1Lu ߧh~ºqk\UhsNFanf.` Rk75+7dڒ u MQ[]D+[/pX1%lmLE٧sWx0f ?k`s2  FҴ>į]{Cl}F̵3O)Kn1V.:aJ֐ol) C.+ XIs Y~]mFIjG!B)SWxLsښ9P VVa m9u6f'dT"H" U C' :2}$FlSF{ƌGM䎰b Ll8J[HDwY2 HGrt5+]ay+-b!xB`bCL#Mk`=Cdd, AQe~=5 ѭPR9ݺ ٛ"%BsG `w$ y) 1jᯛEZڵl{Z4$nW`NC0KSA財˕=ߐ$&ѧBp9$X>˶2:<a)I]ɧy̲\=>M[;F8W#|#hzgW }#n XΒ" WAh$yHS.N6"G`iFXr>HS~`<˫y% sI=2Ǔx0K^[laBDl2҄BcWyCRNj29@3k ,;=n 8{V<;S; k WOJO,!1w!Ylw-7Q'(΀L RX 9廚c7kf2 !A&lE,;s0#:v-kZ1&Ҙk kwhGEkN1<*ԶJ4NqsNbH1Jءw ا ͌β)m]JZNqMa\>Xna Ƌu(p+Z*Y} iiqi(x N4h V{i&3{GiI.Ks,4ܨCcw2Ɏ'mzޔy&q|a qL-)fS֐7kywZ9$t_UkCZzA#~4!2d /05Ӣ p&֟NnrexA*1F=A6aj {ن8s$u.0Vc)a8:c~%òH=aNA04$ymsw_cm Vcɞ/'Hε:8֬g9C*?33쮿cTOr%7,`J̐x5IM_ivV,ؕ c"<X@f6\bհ8RguvrW3]zfwWSOg$m-G0j֬dzWx0Z$Ea]HPQ:B εG4k fjԇ4{A$KzJk S#Zjw@hԦns#MPB_3G(soĴ>$}?WSCZ~2> 0=h5)iAGI*Om,pM ^vfT[gڹԞ#4Rtęy&q~a8sjk4H^C}.ǧ_6紶H }j|sGȺ>YL>'_qFi$ v)Nq1_r+|Us+ i:i倵TyM/LBhpⱋfe3Ugll'Ebu6Q~֭C;V&鴓+^Dǧ|Á%u7!$ciT/!ċ72l\p%Kf{ {bG\ԦCtU ]3=VR7h 3%F #ZX]ˈhsgǁ=G֤ZAi7A\\$d%*"}I4k Tq&O;*aiu04L˳7r:'( @K~qU8:yDы*q +Vըzwk Iu+13&I"DzQE.`f[A$fqY7p)sL%gyp+0s!\L˒'Md&=BHA޳$@fBPLh`M k=MǾ`\tg6GnK ?\09 h-.cRmcOՙ8ARSIifnR %hQq<.Vc6ěJZd9̥ϔA" BV{ɶ%f08Ζ9ߍɧD(QEfG`GQ@.7<A98v9f<25n P;1q3O f ^ڵ:7eitNDl_ɃF c\HǬ`v:4ia+84C^in gLMGܯm!nW[7(@ 6Wn*J̗#Ea%tQǾoW^6q #%FU./nSB@s %4^>z%T}|dVͯuQfcXϘZ_:~IGY.1LZHM(JUeII. #Z:$̀zrʽmZ M\5α& qVĖQ` wH⍭Ũ&%Tsi-b=kIl&3gթѴUixkaj;(pMxsm\iusN`AHk:L8bq-!/M{2GI(M;) #|hQ$@1 ,m͉0oo2pKõw$S@o1:0Z"CDf[I`. -V=^|{4Lq {ؘK{gA V%X$H%m66Aڢkr0446cޞ9 IFDD$Kg]HLuaC{u:sf҆7$ZDd\8\ek{zyM $1?~TTcsF41Džۯ \TsinbAptYuZDE{j&f@.5FW3@uew4A0iO1.$DG ߙ^6٠yV:STǺjb&|<ַZL+47<9څZL tDtHW67T]pV(&i 2Zˉ ZTE@bH}eD5*&5\\nZDXQhk`K ZGXJƼ@ Vqc3}K2 .ɥ+H{էNH}1"V@& +nEgIS:7Oh7MNG1ipouSRxkZ >+R ޣLV=u,isaΟ3!l{W4o!7ĥp o4qoF0$7d5 ͑`~-ؤ}:W5fKHw _%~K2G1-mS-:ɀ$C$Ӻwr^Z-N˔uAhmO=p&Zx9ؘ^.87LX^bDZ-V2 n޳HhIiYif-'Ky!Ā{B0Ap$d17{u)^C\Nj6zĿ)^.!f3$9wESr{ht,X7QLh9đorc}Ankff7BhGƚ[" b$xԹtL:pm a'xu@4邞2;#E rt%êb8&/ڬ^üjtq#|yc ^`׺M܍߹Hᕄg1=S fBOӝGYGHPjQw=SmCAx"oa,e$S,atyb 5H#+Fܩ$ q]J*b&[3# U:Ud(J&^Hv8pѤ%ciG<XSD]Ŷd}0X0Jt ނ*I/G (?~܅9 "LqRZMnLEفt+22 wGAV0b]O1=]Z8hAUiZD 3> V4량S}-*_hh> =S_X:v%#Qzvō)3.{f%jUqGl^c6VQ i.i%  nRhnpwS˼ p9Z;48מSq49DxRy7ihQØ 6QlJg6ݐ>tbaseVHYTT߼KqoیCk=jz5͖ w+4:tFzisEXU 0mMz2}u68-6ҦԜ 0|kc()du>S ,$;5/5p& 7_= kTD}i{K9(:rI8` ]o#Q"7GGT?j_%X711#@:lx<'V$s e7;ap sZgQA$Lk&|-0MFPْ @!,Bj<؜@60HX!tBӼHŌz$I"t3:ǚF`0$IVb5aɓN,a >%nCR䈓Rc\YC$:LFg@״(CD0gq 1A Ł1$\C5:&މYU,{6C\ ZDؖ_ͯ81@t2'GRi7,ǻsޙPR+17,Ke4f$ѧY8m3՘ѥ \|)@}V= :L%ZIqLb}+13 57!A Ce"5@=EfFѕВ-ߚG KJuMRu%FS\] :$s[ 4FQmY\#[6>xY 4Nd)H`vS6-whT6\]pr*9h,gh ;N-qLܛhph%}3wj2/kjoF_h`n`܍ X.4i5_QzxeiӡQ󔆴AOx/}Sicѕ1P ݈fwX:ݵI@ D9dH#AtiYFzxqF5% eG5Ԫ8-r8ͤ;$qVc\MGBҨӘUvPHzBQ^9 kA_L]a ng AET}.:ǡfc5LC:*xdH&YAN$t I1ܤ5՘%6Y@"$M,5x(41!#ymJl56>ej2J 5͂t-1KnkLi 3<}j:r99\' Ӛ ip"yFs\4Z$Km'1DĒZna08kimH \\ Cf% #F!Tsm2D^Ƴq1ڛOVQr7Кꖨא$kPdռ ~4{&Z.5){ZގLvIdh;$-V055gkv$sq.:$d2 UuvW4|@ `A٭ȩXC lE[uZHa SsLqF2nN:i!An%͆CcX`kOFYXQx| [c5ĵ#qVb5\b4mAHu02D$ cy pZc=NJ27oƌy9DS+3!6*FրG;5k" ̐wIKdSݡMSej-?-ݫC#hʙqhltTL:/|2 CŧROvPóu#Ǿ [՘4ꆈ3 S(ƝLFnb}HI:dФ>PCvci'(y' &LI")ϐ=IL;afNڭ#JPְeE toi$n޷ֳ#'-N$ؑo<*{L{ WlHjsD/߬;Ohf:fH-塽]R;G<س!GM3:ÆWYvԫYo$F =)>K@ Zleҗb+Y k$r25b7+/zgެȀ EC4'|O:ҘϢ? 1Crn%/m83͠K-_!0-h C>H΃meGдid5rćD`q ;i3hU}7a̭kZo7j[}(j4hE;Xk%;V*-q1\&f(FoZBK @I"A&F> k>S=A$܌X:ͷJ+ڤ~21] e.} 1t 78 ;lv];w7ŘnyJ4s=-2cXSGw䷰Ȳ~D:7MZ|D!uO[=I)wfBCP@ }HФ:׻ڳ#$3:nnd%#F~=%-fJA0$ vʰϢrk|zd# @"XTf~WӖHwJ|~Q,ΩIx{d ^FܟS&)1 :kn#jQp,h9n8Eҿ{tofU^Y{Xd׃m4iUmQc.x Cfos3r@b|%:}>/Filter/CCITTFaxDecode/Height 479/ImageMask true/Intent/RelativeColorimetric/Length 1465/Name/X/Subtype/Image/Type/XObject/Width 588>>stream -('9݂Ja=׿D. `4h32@]rCRW#h2!\#0 ^̹î$G:Kү JUA:SH$U A רH%*A O#) K_aKW` H _ޖ4y0A/-toؤK- .AJH$A Akj ?m3 unaI꒿$AïҥA$ҥ H$/ 0AA~ I/C$*_ H/7"XA}bI|gI}fd?I]i~=IJH$4$o% $k/|$A__)טsØr1%FJ_ _b_د__Zd*3":.Eo ܙr9T ~䓲>09C~?_}=LuJ_ *o_߰O_5pfaZINdܡ9NwB">M_!׾;O0!dp˻I쏑×M\ȼmBWE'2I ?Y5ZPYg^>DOӭ>)]W_E^};˂l8>9;C̠S6#]>\9 _0gLrw:ذH?M# s /udN9;sq>UAl}h ܷ k^{޵WiV} u]_{})t^)uHiDJ_{-nE_S6Èr `MW_kzl[wutAksdAPg&済IگzK/={uG endstream endobj 125 0 obj <>stream endstream endobj 126 0 obj <>stream Adobed'##+++ #-%'4/%-7/22B2/7:BBBBB:DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD#'"   s!1AQa"q2#BbCr $4R%&'()*356789:DEFGHIJSTUVWXYZcdefghijstuvwxyz!1A"QaRq #$%&'()*23456789:BCDEFGHIJSTUVWXYZbcdefghijrstuvwxyz ?áL$J !@ [D RB`!H! %B!!@B!!@B*u+վ3ֽ9l+)FCOwt|Q>O<\ I&?W^Vn&\E5EuS6uHO\ĕi70 sfM0=OxSZ7F:,S1a9*KGuۭTvމ?2nxl,Q\\U;~nb];etNݥ2ÜBd D=&PV(BB !Bá"*D!!@ F"Q@!@BD"T!!"TB HB`!@B!!@By#jGmP*E%Cel6-7QQL¡Ҫix9h3TW0FAV55ͩ37*+%B0Z>QfoRwL9,f>=Vz:m4'Tx]ǁpSKe|ECmUV=QOK#:mrBEeatvqUjLLgDB! ݟLu,!;3FPf !!@á"U@BTB @*}kvBBHL!BH"P !BB !BBGcun fX3OuD k[6# iKN lr2&5lP2Ō4/RɁiŷ]wʊwqԬK8yhipbUA͜,-~MEbo6eiphsբTh75?Q>WHGgOX8Xk>DbTQR6y{_fFK'BZiLZZ=0b\ZnpW=ְ4ԕ|ux8[ct`Hk%Co" rHxUXb|X8'|Vo3`Rr`y׍$EQkڭ/ (#fp'p *_ql4:Eϊ򚱘e$xd:wFoDŭTK3NĪ_)^U&Bdh|¼:O"ҽn[z5LwS\8،Xd َ-p>Yg$by_ܲNbބ.<,+zNRUC-L+O {pi[jVNGY}BDwsE8nh;~WAyqƪZb,i ^ 9)T{gnWL8=S׹JlўKQw=BԚ|C Q6rΉJ%pHXv'mյo&55S665 yMK .8b篚.*b*p`ߠ^>2S6H/.'yG? uUOؘsOQ11:V-nȅWS9YBlLC]o /u΅۴ Va*5n1læ'>}2D! ! !'`uH@H#7v:č],6(B%B !KG S21 p[KWam]p1AKc졁J,r}# 0<$:@#;ֲ@X:,f1U\o$a DWѶt$([Jflcx 2V@ͦs۵7\ğARo0fA\zDY*Ln ҚIe׋9_8f[ThMۣCӻP-)2! !!@MT|;3IrtGSF-a&TIs{7+-EIKR*A$\5txn_Q R8iet.ڵ~*D2G_^,[#oTbW`v2y;r7"' (K{M+ 137#X",uaAHH"AB!@B?gpu ;g*.á H !* Z37H=wқ[J&mk-܂tֱdY*kf9!Q!"@BDH$ SBBD!*@!L* !BB !BM< SxU[J Py?DP9e[OdF'QSҷɚIq7Q+>_*sZI#`dlEoԶ'M;$. w‰1"!YVy5KUȝndX|cMi); c鿧!VyM}q\73TC$i'#WX|̞VJ2SQV+D4nk.}¸ĩ# pr*dtһ,1ky_LvtQU0Yjz9)f;}+7jS+}6L8sW=EE9Eera ;r!kdL*HB !!*DJB X uFR^ k85U8YOXW {;!s5ա&yE7kpV}ª2_""HBBD !*@!L!BJ !J !BB !B^7x@AëUk4X1;ō`G2~1Y?$q?4{XQ䭌x+5Q6Q2|y)z+ ‡XoE)DFFE[x-n5G6r3xjÔ v<;'s!Eem#0qw8],?f툀x>UޛeUf%=Kl,sxK.;zLU8X+Е"Ԁ!!@B%HP*`$JG29 к, 6p:YEtS4N7\d{n 0R>p}vgs{[kF6a kߞC} JeR*! P! T! !!"T%BD@B@H!@B!!@BHbpxݤb8uC1]ZjRƙǻ.?n/؃KD]cӓ_RUBcٸUwxukG[*/? ɻyL8Q2x(p&dMq~{Y:*k4ϔ} vN!sw8Z X%K!$rIܭ)"fha)`{ E ҏ^ WR+It$ "pb,m{hTl|Jjc4%wu~P hg|XE,tP2׷CaZ*#_Ķ\f'.@ոqh樼*4yԺd'4D]tVc4`7ot48Tw+)BԒ7 HPָ$!L!!*BT! !ca-:;.!dhZгraLS9!Q!"P $JHJ P !BB !BB !BBJ^uizIBRpōQ8\=pd*1wܴYH/G⯱!-9e`USV)RaiUN"-Gz<~X339B L粙Žk 1MWPr_,gM6YR0{4Snp'0V:ݽ@}{{7>piq;X'1Q؄v>GM؝+%nIZ_$1O5{eӰcuFƩ=]F3tⰮ6]VF┹^7pFb.;E^V`B$!@BáT!!@J~-'QSL6[0!BBB  P"T!0 *D$ !0B P !BB !*M+%ik.GVvNߌۮ@ȼDwǼx\HΥp\6?UA]U$#ٝ@گ`sv)!aڳɆRyț#A龫M3L( ,qɽHt5MRjp3qhTI"(Zhz$1L04QӲN;_zTDNұ>G\[x:FIqlD5\?|/tZS\$򛕊ng 'ke`{ #'iZsli{[#F')jrP1JO)cxl8}ڟE4SG A60"f٭;)?8>l:*d׎>7XVݨ ^9qc1)Mo4NARLBBáT!!@;?M'ZZ>dB !BH !"P !BB B"P !BB !BRQNɚucQ/,deF!QaU~UJۍw6".7Q[~\T*U-n88}Uh*x@v3%:\3q ^1G=D6G{Tz*(V6JgFЃc~KSU)ٞoAߪkz(phGƕ޳Zgɘ{֥i;h5i }NOdp52 ,4|Ty/b:5/Ľ{91JLѣ"-d\|JcqY.pL x-;xeTX:=U4Seo=f #IӢ kMvnϺIsT8L+)G~5Z#F6D5wH ,`!@ !@B%HJ!!@B!!"T!!@B!!@B0L@Lm{;צ%1x8uB7i˰Ye;5#oN!L!"R%BB  T!BBB !BB !BB !BBwVǓq w+Jᐺ䁯w[. \geMNi\xu)<.SA=yT-;@L§3^ڒѱ<֊]Ml"Aor\'%1*(\:HSAPS ļxNԴc#yۍm3JI.:@5DD_.a0q8dX{J9fk&DwݱwGMOeASP㘮rEiauc{).@O&wg(%}65SzKU`s:Ů[ǐja.IjgV9BjkPqZ:Z٬Zeqt(^Os 4v9ٳcel1Et7ʼ,8m9 ^ î$F7 պ_rE1L!i4./c+|~T:jnEGHIG_dB|ab-dj^Ņ@r(ߡnc}xzBX =sW3GC+K^Ө*!BB%BBD BB !BB * !BB HBPlNTrwH/g׶0v*ٌ0V1h %S/- %F^ޭ)0j99cѯPz;ߘ-ۛ wXvARNRtrYpDV5e:U|$nBUW2a;;liffQTVēZ1?.5vqT~%Vah=9NQ7UkOQ ѽ\}ˎ{^mi6vig%XuںԗMC #jj>52cMki$6\R DX=SWyPؙfןݫ9aŘc_Fے}KUZ.ĚG4HofVj8ޡ=Ӓ;.(dváT(1 %lѸct+x"`6Ҫ'喔=}m LNBj*G\_C:Bj; ggrN⭝dCsHi<
a~H\YZ]-{N yQC_H-$-% aBHBHBB%BB !BB !BB !BBT$B SiVʊ'KH 7.W7i:2޹Wj,+f"R7cj3W t+=y? f-{t)5D[[uY+jه`nuMIlN~:'F|VYj;nV0l Rl95n a4 eMӖvC!2*Dd .z|:û1x',@xeRhqv{7:Vɚ#]0Qf4/bcG\#(80Zs&э>,3enRVU _+E#1*Pnm|,M-2I Ig[bSZ onlP78էqUXx4gá"U@'iu3čA&E,uyv :+|3}<-D&m ,Щ7)V8Hs4bx_\$(HZj/#OIHh+ .*C4fw <|U70b KfJIa=ןxg>R3Ci6.nQԕɖ:j&caljC.!!@BD@B!!@B!!@B!!@B!!@*y!yObܛN Ȟcpp6 ئ*[›Eaծjט&d6!ڭ ^1 FK{wUyAF3$cY#\'$)8=bbwcZAh_{lǟ!}I<Tw_!plj^(wJ0h2XL<(p.7+gU#<ёS_Vڻ急ӛE%,b))4uG0p.5ֶ4C_*b1KF.,ӡZ?CMi?Qq¶!gáT3%w}O8z?VXt8}['mcb*i'tQ>Iܖj5YKf'E$qI"FUOIAq-77qV>/)M4ndq3..*]'5OnxL h yU}8 "l@65~॰tܑ,9I5ζس$F !BB !BB !BB !BB !BB "moi{/[i)fl=p?'r*y] lZA.7dM\k.lה|@f^/P0WG#0<]mz][pl F6-: LVMi<gaYl꫅$&wZ-uYټ 陜IZJ#i o-j5QUVU<^LW9,Jlnn')I>J6nq>3a+~~`}EQ 4;?Z} jäJ@P!&J'u1H$sTzE]qM[~acTZSHZlZA5EPyefckX5aˁL+4&m^<njQul񶫘&Pãyb`E i_l@'r3B 4:n'GLQTaߋQ(U9+E-0S+ 8Kc^yUS\@Moa%;>U5HA1Hs6^vJW{~CGJz7áT!!@+sM:CYK$rK^܅D!!@B!!@B!!@B!!@B!!@B!!@BPpyYΣq ߖoZu$̙h=udt\jUʩ*G+f7 aX ghtRar 㦻jaS6)GQ*7  4v;#ѾvyM *"c(GJkdk]ۨQE*Ii6w[7><d>}fFƃ1>k>Dާ@áT!!@BD@B!!@B!!@B!!@B!!@B!!@B!%H~Ey7SpPɛ\ ϔ4D>P>0kbq6V׶FbFpq6ŚJ%op)]ÂCA /yx8Mg/WWD,{:Ï(SV\S&b'|zɬ>:*wFe{Eagl#ѽy4n,M4.6ד6gJ:Mi+N1^~QáT!!@B!!@B!!@B!!@B!!@B!!@B!!@BJMC;4=W: 8}K&Eqo) 82H\nA i0W;s& Դ{յu,x#6-TQxyIH-áT!!@B!!@B!!@B!!@B!!@B!!@BB@!@B!%HWpHb^uNi{mOUYᝄ±..>߻{;F'DV=wr!0JL6fQKVE&fxrE315.i"n =IlȈ5^)-;a|C:**Xlp6slymM*tjm`äJ@!@B!!@B!!@B!!@B!!@BBBB!0$!!@B%A*D =+%y/b߇O5W>OGcgxAk|*0@{.EN'ST#j"`0.Ǐ!s _ q]m"[ x Ffw\:e"=`>ڵcu!r/áT!!@B!!@B!!@B!0$!!L! %L!( /a.D*)xHy!0AB!@B!%HJ"lu?LGiN7|:zrab_ݮs'1/My=+V1D]fo"GV 嵔RdsO+XY+A5o%áT!!@B!!@B!!@BD96AL!JsCzuOThYjp9[wFCC_mѳ@NLʶ1DN? 帆h }9( {r{hN%NJg7=jHf֖:BLg)B죐2Z~W@yuD*DEK[Kr\zUixKW!8#q}ѧk®(B!! P%A*DAخ#ԁ=> _y7i'R:k"ݴ6#Z NnJ!G'dG(OáT!!@B!!@BB<6@+y#8_+G"].>άfPG4:DFk{ uH4U0ꐧiaSceb1ޭmWxS Y{I`K*W=Ĵ7~Px}c24gDNTъaqFfHØG"1`}mν)=Hp#aJ -qKѹ.a66ܛ-W֎EJ=DwRfCj阌u DFUT1: yMXNVm*Kr%3]B8-ol_٧V@Xﵕ}Uul3W9qI3)rQ:$LZf"b',CqV5Jە ͬijs6¡hҗjZ\%]SyHhUܪ9mG cN3X Ge6BrZc]cr#X.4`JiQ4󼰳󲙃?lyg=TnDƇ q; Ô7JI"! RJ0!T!2q҄sPc@-'±Ip9ћfm[}j깮sHáT!!@B!!@Bρ!xBY*Άgwo#يS6Jg|tku$w7^j#b獁H2E C_ zD]hy [QE⨘'h!_b: ko4ij^4:Xe)AUDMS86*y4ƴͿv/g7I)ee˺ϗSydir/5]\0T2{ep5Vb~=Uէp-v|Bv ,3'Ԅ1o S?ûKs/߂IwIs 5}E4)ZEi:q ~&yLGNmúOV>ʼ^lvVH0 tφ"DY37BABP0!0yJmuRe?áT!!@B!!@BEut, uH+#x1QPu9Q3+1Rq碄q-1N>< ܍4)Y2O2üV 'i*9${]uq:{U)&r!ĹtbC?)kǰfih n\og{U}nph,%evPgDwh uJMZ)*J/iVSJƖ::'ـL76oۯkdm; ccoG&S459׺9;7`ӭmc3ʢƏyiI ďpA)&7<~$IN슭TɨDF÷TkXF^eX2"Z/mTeD%s{[nI1͒Z޵Shoy:XK#Ahs`xp7K mgJ+œf^7Dlg]~3{ O u?m_u<&2F$ ).jvH>(Oqozf] ʌ楐<ٚ H;8qp4$P=#jqwBxNS9yFW x$tjq q e gKP*gT3ECVtzs'+AeÎRJ}H\8߲jF SJPˋK ~NFV=ͳ\*ڌ^-4ΕΤ+Na>0keOn0ƛC~WM)¥ {U˦nSi?UffL~j陗-',ے,P5ˏZPCgXB!!@B *DP*J* áT!0 ! !!@B)H rLZ |OP m4uέ 2Q_ş;ħ/sk7;85R=, ]sa09>k# Ęy$# fcp1d~,[ݾg}Gzl 9'ߔT<@y\'h<쭝n!qwx:OR֒HA9I❠,5O/d>4/.\5Z^+cG2wyۚ%!RQd@Hu!TXMa-1w]Hc#I^))[4y5:0 o8#`PDQÒ $%e9!&Zԋ*PK).hӂ1!U>]~= *i-ą&HWLPk2f:k%}3{zfev86KvaRo] w>e647(T|/ϱ{-B{ qؔE+E3Aoڔnx"FYWLۛm*74t^nѩ\P5'b&]u9/u cֳ;mՓ4Ǽ s8Qx̮B6]Y!2%BJ$T!!@áTBBB@!@BBBMz'LWq1 }3;rzy Y&iot*}~eEk7FQ%9KQk3lIad$7!=UdoCouZ6Umː hvyAx[^8\t9)hiXl˅nE&;iNd`pԑ艦athՑ9 M< 3;L:ob&Ct6YҴ^ÆʅK "M׸!|ڝzM1L^؅KA|fCi!ԧM#1Hкzv&'Pl/x32 v%l;(ky\ʥ(SXLErWďԑr4۪Nl dF)#gpNG/bKV:ZTpOapsf=ƈU.-ߞҖ77 y)-cu▍\=e8P,X߈FXs{7]Wq є}>)3bB,L`4OHڦo#: #s5\kXX U\ -ne%t= 6WLDhLE[sC:oUa/ ppM+,^|"(zaaQ3s("&ݳ}@Ԍ* D.|Å"tckhx|ni%rT`nO{Dj&=VmN 1!q{U i;NNFV8V؝CJms MeicͺGQLcEEZ׺Wӎ1ƹP:#gP]11!A$J *BáT!0 !B@!@B[awWzZCPDnCE..m,ekm9#!\I,mQҍJ9th: r֝#).ԡ@c^"ڿlڑų 8QxjKh;ө]J .8-Fݧhkh -h#(s5>bEk ̅"{WZw#囵AnJ~ Xإ)tv&iIMOBvϧe Sbvlkb~u<&[vgn 6r%]LZ=JOoGjCW;7H45=MyL.tHݺ:7;[$%(/lIB=4V4Tոl7‰AR3x18ч%H(Z^MaprHJǀ7 ,ݲ;l ՜DsrYr+[3@m>nTeqxRT(Bf@,7",nGlgy{ES(SM31z5uv\?3]g "<dWN3MqEQV[7Q,./QKvaڅqL<,5=tFiW*`3״ڪfYǪA+&hs\~F5h-!%S89*1Nj)-5PHo)X,WZuj`^mYذBƒ 19^YYiMVkq,і$Vb!*D!áV!!@BB !384/ iq⯨|ݷxz%x1vt-]O `hkT\BnFGR*3 vI /;C p,htSe$"0!BBƂ ŒG҅Djl$7-=SɜjoE+LM6NQm4Ly86NV̞:рǪJhb%hܥ9QU*pf$UUNG ~ulMJcԇ b}e!SpKx^`^dr}"lƲ,xʚ8q!EkMۍD]{8-/X `x8&;2xAɂ^D3& UPqp ~ŔǾ/Z٭Sٽ WFW=%BWf@*B`JJ@ا *1 x&i6F<ơLԳc"LڨNLKM5[onswWT3 u>)mC^^EYc`QNlLYo$`"TӋd=6]֨m, 1 o'*{8{YGwظ΃\fáV!!@B%*3+8wBS6k"0L .:fSvo7N^fC2WRj~e)HDDET33B !Bw[*6i,s |6ѠZ#NͯFfC]׉s\y>B t\#"}˒yD7>y p|oVƉb]`5%NQTJ4X&f${e{H܄Lc*qÚc`Vo}Dm.8s*6=q*q$-;7]mS] ii!z6d,H.L~YE;{ubchcm{*wcM$},.'"&fQ5Lzk`i@uR(s~- K {{BXex;S]roЧb+@WJ%tEeq`-ctTM pn wx!jZP; ӼYfo24NqB0*! PDJ* !H$tf$x;,i1GӼ9ځ+C3H O,jr6\tMsN=ۂJ6Nַ+[s4P칀=tڰ`N;DY7漘u擲jháTB ! SfphJd&fǨw#u~ff[CGY-.<Zŷ= Cys#UَͻNSgqyZ(,ţhuL+rB!!*D!Pke) ]r朤E^E Zӷ=:eClkُ7%Q}#h.dwQ-QSe$~jc(klfuLg6%4YT8{VGlGR2@ ĞaidC)[ؓşq!Pܥ־!EtcWE٭h18F#qV27=i"m(ec18Z༲YN|fX FNf맢m/s@"A^[ǗJ1#@Tܣ4VgkݣP.;9{ 鮻fn#Cf0h߻ fN~+7#$_F3xo^T냡p:^Em8DL&k¦B3! !LTP"TB.! DBB{lfďZ-i X*c?U;RP)vE"3áV!!L!-@۟Haԟ^x+2K{nV\ ܕmQBb i:ѢI3B !BP&! Oa{e|oyZ6?"a_p-@1+8\f7 $-VWMN߯[Lbu5o; C*b1$,Uqpۊ} nF|5)B򞲜1yx HOJ6\ibZLreiŔ1o>{؍W\:^JL!UQE%S}T;&jjT|NIw7.qϑmy͢S9UFإsn֛BG ! !0 !BB! B!BD$B!!*D5Ê@ 6_pׂhzUh ;\x%{6gٶ4Tm!(R-1f fs"T*HB %B@!L! !0$BPNCu\-Th p4^eC iuK>03Nk4٦k@ Ø$jOǃgwCpyTA**" hߴ:{ͿϡD4q?e?Q6Fä.X{je&՜M')Xi^r @..tC ^HBI*懀lIЋou.:4^\LCx2kmZ'No :]1+8]]8jx4^WbtzyA^W1rc;ӢSf<)nһPT%&S6!4!HT!BTBF&ABB";!"@ V8Vkdvf}.Ӓ, hct*ںS] s@W TFSEFJ%{$Wڊpa.5|قNABBB!!@B%HBaCi)=#v́ d kZFU{d]*]S挶qu&$:529mWT~7ݣ"Cc?i{JTmq^Wb_̬=,2bgLy=gQQ\4ć $ʩw | ęٖqKOe f`bEVgӖ4PXp;>ÕU?oCuUEដe9p Dyc YI+q8EuSfVkk(m6w)æB斒y]Ym`!$J !"T "T!$B ?$J`B֗ jgTѹ[Z:fa>ޓ$ݘ. S|E)2 7 ·`OulCghB` !0!!A!H ! R ZGtWB;hgl^L0C{k~l}C\pHM34v׵iRߐI.@>5tS7ue,/,o<8C)!H y5L|K>ZD|DKlAG$5H\8X;(uA`5q0rwjy,!#ɛv./pZׁf8t*RP,*EՖVX}Wb^iNJ6tX+/0wmEtu붖Mtvyb׾akXEp0lǒbTb٬or)2Z86rTϐ!L!BJ"B %BH!a_ncۼi(eQnk@0lUQKG萜T❝O}\/$b#uҝuHDYAB`!@BTH" !(EDBT&%@"TR2! P%%JЂ^ӰW+ DE=#6LI6⣙%['OF3| ׉gjSm{;_4ٯۥ|сRXeI^u?L}Ugo81o'3C[E=?Jj_|܉IRkHvL?<$F\\3 ]~:;9\xp#HcDƒqVcm8`inwN֗e_U־Jk$.N/gpv)& b7-.sdYpAe`0Bjgn'Aiscj‹K+ULW Q[Nֺ{X.ii S7-N R*r!!@BA "@'PM5Êt"USa)0n@Ԧxu)m,fS^rJVFB]iD! !A2!*D"T@J*K"B QE麠IR8% :rj.f \LU. n8L vKA'RZshO)',mbq5SO@`NGG&}./L5.FoSlt֗ Oz{.t$V}ǠGP,Dݖf&YBJ$dB"TJ!0@Ф/p ^Z6 dy=ѿPbà*f#Y?~:\OU0pJ˨"" J!&PRH@HR /A!H<* LH )J Z1sYlbhrge!>{m)j#~GzgqzV絈NZtoCNK &'"Wmt=3p\=! oxu4Ml~"\B`ʇ8n8+yCXkrձpX[eȣ{b,/UY&!d7pm%JOONtmXX9m8dLװV`8H1!7-f"<88Z]Z @!]]0Sl VP*$!@{Jᵍ} ecfTzDmwX2IN <~ԲÊ@{-E;cs^ܯcie6w8ŕH A@B"T!  (B !*7RCF,b+U;([keA]Zkv S'& Ekd^}*u Xn@m\p$鵬nw5h6oURU %F-B{p6qf1#<$qq 8YJ,c9U1T+TWV`@B@(BD{> f$X=WWs2˜u``+>8{76QTgiЫ^+mSML\xqU-\x{;&Ǟq*S돰L=:X 5!!@BQtH]Ҡ>fsT%7\EP@!@-%J Ie%"@Чbm#vwɪr;frWT8H&c@o$HD*r^mdJPL<-E,)sN+]ImC,ȵRvJѩ# ۼ_hKϱg2Xb> %}7'Y51vA(+꩙2x٤7['ã/' M;{$}5q!N.<;%uf"! J yNAL%DKAWx"GiJeka\\3G3#x ΫK2 X]sSV,}e1׶ '56u'B lWJeD!4!EH"fJġ*,BJ .*a.Ȳ@( zi^mmqBlz( MB#i*=+ j1B7 T08*WXah[U' + $gQkOSdp)F-ZCx'sy!%$ Ҁ m򜵅.ԦQ/"S6JVDR' eiqu|,5Zw7F m{W84 xz֋i&33t wTn$62(iz~us6CұJ@us*YGۦj%hpw8SwGz\/:<9- qOl$'9+7ڴ2@uh \LgR-ג?le#Pѵ7CTأ1ib018ܴCj3$ٝfQ񍮮$튍 T]Yd!*K&BB YQT A~SpJbꢫKU5|F&MmFsLmg=7kFIw"'CG8ۚ\M*lD%BdD BD% lP@%@zIb$$赑p/l[hȑw+ȽG@ꟚV& DӔ/v;4Yu(dv4SHdd[U6Gg4hr*+./AQb6.N6ED0lDuIN"ۯCl86N@̅3IMV0_0;e(ZOzv+4mH$LjRfQrty7 B-M0nGEh6.Ru2{Bfxl=z;6tѵh&CμJh_AY48Vo8(9'acdw *ۑS eDcRnH;>+M,skla; =3fdoc1Nج(HR7JY &R%AJ!*DA^߁ЅyK,mFNmS+btb[GjCCǩRQ>_A#Xۃ{蝊yE#Kv3ঙ!9<.{xlSw]2JB6BB) SMahX/ry:$SYH`tLQR*Mʼ/eTk( UcPng$ @x7@ \.Y&ȰyJ AHmxkh`vKߐYߑ܊=#qBj9<T *F.Л NGIRV6I&rVFڨsE{V^,9L] ^rRTf*9<_STqziv $ƃB.!&bA-<6FS1V;nܬq"rYH2j/O>wk/CR.!)D3DNTҖ {J@*9s·RK|>\| ^"إiQ)Flt䫧gX><]C-N.fLYٙq UBHP\*Ce$n-$*VIEَrTPPTBTJBts3[핫ʻQ2ǖWt.$gl}&-C -)5f7o-, ]$Yj,:7S4d~7z6ݴzz@p*EmSQ= rQ܅#eF@BaLS٨T![}i`h`&ګDٛ1*/6sЛZt DTX@&7 pš[e>6kE bji+ģϊjjҠ[uکUB9S6uIO]%ʩ\a+s}TW@Խ.R\6.\e8WkK*h-Reykn %ckGyٞ0}!TAA/NpQ~w!ұ8n8%/oڂbQ,v <}CڂQoH @5&߂ h/& &ꢶy5iy\4THg^Sb]L(f <2KQ$s{m}>WB9S9%@ V9JtHDBB !0!~nv;TM%-@0DNh:/mU]$0X;cȫ>HU' /K:Knj6!Bg+CrzH,BWMI6 HTPD0\[!{ch}Fa!eQUa:'sTB}E[Z:D26ىwz UOObN_J${_}{Ul̯esA$VsFeY)YDGc7c:3$n[~=`Y4Zf<;E6ӧUaÔmKi#KAD' fN5U={>h)0tWP*͠UM,MA0'}+fa[LM ѠGjQ6fH挌v`.o2ws-73r N~ Ƽ,Lg47sk#sNJ,,s]& eaAABk_9<3=m]0\˹^ꎬE;s>86@-kY \/)j"g-sAlp^QsO4{7RTfzmS[`;h(U1p GP*'Rk[+ZFU($\Q:ԊDe1m"&@" vw<`skkqQ {z@=B*ޝg[Xɘ 2cݟ#  HB6Enn6WZQkCŒ%v(@(6ZSݙ߅mUkRpEX2N+X5Ņ(pGYy#x~5Iu/|t O3g;dwLktY^c,-IAݞm"E%L"ЁQKpaÛ{Kp ^1tn ȺҺeV2:omTX2xdhIF2,TpStbOvw\>bV#e"p2^M>hsN"sZ:8򳽹7+H( _]>IJCE\k L*&en%V*jm~Zzi*sԴ^n0pV!s\fQ1Mfnk(;PSnU,Ν)KXk2n5W: F^T̕1Ɯ5Qu`6 C8#H?[|ê-쁿luZ֖UA_ZH;㪵gmsݵj.zǁIl;4-f]:(nQ{YT99κeY tI,49@yJO qnŹmM1tUK9)Fc}6n4ckͳWTB,]D&Շh~JxNX^8ܡ9pl =q Iv#6!m|&Y\demJB.:~-SR74\Xx.u@-Ɉ?- o2x{ט7ԛf1tm6"mi/lki>6H ,u3FGxX^A7qi)XľWJ͉uSvmžmGŪg^ڊUL>Ue9}(un~")S0҅ΊvcJΕvd4F4X]tM>Ɖ BW'7wۦsrg-B;:w}r͏#Bl[(qi')MXTB2.;z+إ Kw$hاrg!gȋaіw{G{p .*A{,l{x^HL*6BJm%q4էpg%m(Jֹ'it st:.iH%y 5y*|Nu*dλk] uFJ&ʪ͵M:7hBh"aLѮi 'A#co<=S;nxYL9"ophcodk]"QHà^PI4Jr1O"Wls, ]ZuQN֏>^e ,{#᪨i@fE7 ; T-\9^hDΡ'\@lmQj&Je vI>ҸirR :I^_}$s奒Jlƶ;g&ع$Lq-hU̚G4UbڧYpm8>3E;G.7#~ID/7:iemm&$Yae2Xhqmk]Bdtw>X3딝:pNJ&2b9`kS h_T1LߢN/.ҞȻXblxl%N|.4ڀ UF471>Y~>X@u܎YDžr]*][#ƃkpP ϔo%*XN`Z:Y^DCqs{s+=jɷ.UX3/Up`2޾ʎfE&/u&ZKZE EȤS{4gaOK"3ht]33;FFEusDyTF"$v>/pKWsfG?R~"&҇{~{lޒ[U[QJT7JCߛB5kٴ[ 7L:.7 N a951xmG:nSR5(8!6P^*螪Dlo+pg@M3ȋ.Kv\$$6ǏS!k#s(P:vᮣܩL m^*&F)Z`mtё>𛚖Zy Zěk%SˏjI-ToF \6 lGPw \kEokk؞L׀֟> lya嶾R2!s vbmRۇ츨ܜ(a:C]s8ܛWh֓} F#e+X=N[/-v[1%ל|&aie {@iWP28\6_UW^=OjkכBfYax#9hްb,Rw^X}JpEؙalkmUmYs\KDmд:6jM ,Pe`֋ |lÚDu4v9w!j#lӔwӢmiVW83j~v6Sqg5;uq`RK{EDp6@cXQ LYpYQSC(0 -k;07-+j"6G;u*c-\qTkwIMmNԿChDTӭ9]+ȑ2(Xog-ۨ[ *,͕N:NrQff[^Hu&fЀ#aTw]Q2*-ezs.Ç%:75nt]Qy|`xpLyo?buXZci׺jFϔ@.6z- 4;^*+BE".4t:p^0lA/ A?(^< 5+I"{=#@lQ{ tp[܃/bK"6}oк8)R,$P2H]nfz -ߘDIh!/b|&X omhyr ᯂ.01< 9훧t43$hhwFG+=k]Mq'r^'&쑶#eUvټFlNc[`u4\MvU.kւA{I Z,- qiW0XuLԕ!~z)Q4, gNwYRT\EM#[*b`%m]YɆs6ʒZ\coEΡZd3=lP&=KN0mg :Tjl{"Zˍ8TM$s-q vcq"!,̙ p9Qz5ZXQ3}u4^hxOe[b!k+pZI0,n?d,%HЇ 5, A9]kN0%vшmuacd4 -Z(kc|8]% 朘ȝy+ t%4-ZuLkby/O<5@Bk? MC2 7+B`-Mtl^R`3dף,#),tꪌNz%xsy܇KU5x#0^)cect"9276mm b.C=7s{ml]ǜNAT9tg&Iꋕc 7ڪwn+lO%џ@89믢DCd.`v)4EI!^w15kR'\!(o>`6Yi{_ 0"6bJ.-/QS{˰:YKu.Xh99= &L7c܋8h E>ϊp>\nI"8C/p Jv^ѲhxRqI^Awe1Nv4|wV@v`;)kv.Εɶ \UEZ$sؔW6$1yI'(sS%K:mŬnʧLPm*5@k{3W0'k{)XA<NJӐ `%rP> ϱx526BNebMؠ!"G86|7UVkIsHq9Dx!:M׹7^pvm5"6!mRETrܰiĒ*aKM௨ {&OT*:2ۓckrbyj5i$dM~@\I[cϥ,@ctz#Ku(biyU_P33mn buF{!2oi8Ι/*4WS⁍i5pflR`F2^Jh}hxs3A9mcįt0KRUYMMCQex9oQ+#,n9 iWgۣˮj"E4gKYN25huKEuϊ4 ҹ#f6pαWLn5\WhLM}#.\(?6`8)n[xބU?{/֭)4 ^}x l 7Ni]vly&zzJfs{S4Vթ9f>" :f+={~- J6 2G` e#t q6M7܍,@|#h5>Xi7)̯9Fp8kLS8Ҹė;O\/x$ܒ tvQ0{k!.h =[ Ҋ B8k]щDAU69LAĶ9j1R&h2ܛZs^}ٽ:ߚ~:5vQ ͮ<(lce‰(1]hMO2WO,-ǧ[umet̸d `kH{b#:d&8\/Q?)#MESg?f f#SXelt0 L8 rf\1%5D%t֍o&Ǹ^мGTv]P.LWgB>*bEfqϒ>̶}4 wq; l5m5Z#q`k.NV8P$fR6HnHTdx I:)QXf(ΘH} ,Kg:8lٮ~bZn8XjtM>.[KC8J4;>f`#ޡ ٸG%:S'bÇEx 4<Ԉh~ͯi.7yC{ V3s/20OANɁ,Rau7']y^26GgqPE=KNɔw)@oYIv5%m<u5$!ITEc y|LyXm~6Rc35^i -n|k꓂ ;StA, b۴ST>ső8 Lp斛_7zuGD֬wDފǥU>$=B~NjC_cUDDQZZtK2GZvʭoL|ID˃q}lwJk)%B0=W43H봋i'c6"R. ͑Sd%@lsom1ӫPcCM"-lЛpM{4MU9n[#yHd~%)a2oӁ^ж>!C#kg9Qa"#uE? 7F/4rO $[1ăo XKe枝ݬnSbRLqvFZӢV6 IU 3LH].V8[D~l=\U]MEIiSIԐFpRY^73\$39ƣDDeSpItnUQ=-(!bYå?E7q#{(W,2(ď;jZHMʎ)Z/k9k06#DOv^E)4(sq^ݯ)}5=Jc=(r4d}}i^(ͦ4  K49~7Jڹ#)([V-r!<=mtA٧6FN#e?*4N#}Qu`Eri\.ʤ Wa.BKg쟫c_)f,m,]p <^ ~zC9M8QIݱIny]TK n[ʺY\.vDI uTLi{amk=;ٚSM<즰X b%0Zj7s '+Fv#Aug;Q@x0OP Ko5s0"*.i@oT11rTN/3&&$Ѻ7RctaW04EB4|y< i$'̓s_P.tD&"P-s82c u˥ŗa%ߒp0G 0=G=9?MJܮ:뢉M]-D/p<}3<^ e5_2R#ã s[}תOC u˴q;~;Op#|yYH0#SEQl@VF@A!5XHDSAE<5/⤌>7 v6;R9ckMR,;A8\ į \ tW)q8zm}Ր~!Ze h捎C1YX$Cth.q֋5_Da ^ ۟1ѓQUQxE;7o潳4c nW1[vXܾ>QT98:WD xC@vk&Ukob<6E5c0vvDŕJ q-7yx$gu'S)C auDmb5M8?'xkmy/{oWzP1?aN& W( p(קMZ a)qS'!\5K}h'S 4 (=/CX"Ͻۢ |Th&ɪV3r3@蛎 5 N\I cRגdR0s ߗum%ΤtH Xڴe8covHR=GtX.F{knEWghL 0!Zf5;DG4{Fc֐ja{d@@s-uʸ6];knWQpɩ}xW@\s jGD&PO:wvLGZǷ{P)IQ {8H;6OF]zʆ>GIa{DrTV,kaqZ,>bc h :V@LB;lB&37֨':nJo5&dڒG9349ZFc#"[( K݉A4M9H!~m!Hִݯ͖iݜjpULvF i1Zs]m51^Rg1/TxJ+5V}#L&AVTӂk^)?+_R4x$SߊzgEMgK7Pj+YosH'GDL1>.sd~fgPx)acTS|Vqlt\h1Flmbi]ujL_f昍M-؃pIɯwS )T7|Qtꃎ6Jcy NABT3Iݽ&,Ok{i&K^)چ<؋+G6oȧTxm=2m+ 7 N=}齐Xە%wznL⤁nבO6w@4&JYԪiJ,,%jTTHNךj|juDD[N(=@}hs,p#c]aȴOl\#OHmtMqc :66Yg}y# ؏YR,b,M)DE6!r,:lt?2zC[ 6 yFGmr{ ":/!UKY0ק⭍Z.]IV\AtEdY33 p+=e"Z5ún'~9&s/fFZU>65 NbFr`Z^ 5bI;OYX^H[V(Y.oARbkӌeTȲ4,dH\b6zC\D)4R;nu(60EK{9ؾ`6sq_MyRj_BxEg^6HrvVUOqW #%c!A)+n W5ۧu-!吐vIS=~DsQ/P׉F0%6<,kJ)Ǜ4_h9xkn)նBvT4 c0`k\p^f/RǼǚl) 좺IcqhyL m=\)(Ǻt v^U4A|BNT滁 7K1c_q$Ok}oMGw \s:LyhBFbiBƖr|E acy24 6 su$w^E!{,%7 e qg<-)v[+On18w$,nf JclHP᧓;Ip6;6j$c,{a0Lv)*MY)i4k]E_#ąNF=[ZX ǘUv eݡTv_Z. ƣ3&=}t;BCx"r\4* 2XIuٴ]L43,nLZ=E¶9_fm~*VNVm0;3٘t)_lo;zdkcMM#ho5k] 87q{tDK)C/T8k=mrx%(1_oH~:ʖɗ>g0T+㮣͓%<@NXfZ#[/Al.cbFDr6ꈰg&?h{HTRrY*-E@섃~)i[ssXie}R27˾}Q)̑FDzeλ*%m^qEjR@! *CmTUI>Cfw^v< {C̦׳Mê`0:\zV6nP/?-D.6eniZB]4 n:6lBXw/S f[\F:h^IPasfzysG LQ8s`wElAOlepyThTԲf=]6^L`k4i\[lbmsI@WYcu4.nR.Ӧ^e$w"hl)Xt+jeS{sF i؁l}s|dӮi=Kd%ٸַ4_z(\]"dX}׆%^EAtT2Diq6٦iA).aWa~KTL5 9/mMqX=kp)hLOsŁDX?rx( ЕCON{G97 m\Ɠ tƓNܝA@X-{[6ݘ-PQT4x 'hKZLvύ Ȣqy8eK>;V@NJT2z'Fp%LWA?(`؍)-kIB'n<8Ex;srpy]30ߪcn6L:Wr蟥[83FvK)PJYr'_G+n"v ؚ \AoRC+toP#ԘdgvŅ,Gi:[m:AOyx/뻀(CuGY$rt=ѥVY_M3J!f9A[b7Gf]Eט[x -l\ !pCk*U]3\L,no)sHM$j$SG6w:'i{F!s%íEJBE(iN(p jh 5<lz
    OodaT5k$y%X$p8cxo E z~E>UigcA oT>lZ8K$-"Hi̝Ž c3 [m\wRE, mT9As"l'9,4Ra9ly>k C r+v%*& _0l֔Spp+B,cqy¥glElTC&W4_#n)G#xpWFԵi"6LIQ&Vu%<3Z$5"/ZI$FʢYb=Ec1YDo?(|nn_HXq4;Qk*gaP.j9E#qM~0&~fղSJÜSP Լߗ-s"cuFs;1_eP{vP*DW(\fªi{"MB|p'ᬌTKCWؒƐ:8W%{ WR0kd8 -Ee1Ex{ˋUc"RZA'܋)N)a}3[xuQ;NalpF{j"G5[sdښ7 aᢋR8x>Zʖ=#RfA0\#yywElxXO~ 1ct&kEoQgJlie鍠v ̣ר^cmYźda^ ] ȣ{"8)QqeXWo`t!{ Wnx.HX2򵱛 .qLZHo7&qf$>I \N`s뱵dK13;W%cAlTʩ,.u0s6{ٰ]8c@П;̠Z@R*\ieo-SLc} r1&S q"K樒+h6h'Nj FHS*Y5 `U;4SH湠8s׆,w^Z;u-{c lXE7謜EWENs}òg/֑3ݤC~ŰBtv*Λ|5MoEژRUysIׂ@-:{ &%ג3qR9 s+I^ ,JBK"Y%Y<RK<[/HOm9dL]5%$3j4E 9b'cF1GAlQkj!P卽GʖZ7JAՂ6ȲSIIuk.|b;DR)uletg.DHӠz%)+ѵ|B0EuoѲ^b  #|uUj_7wiQp~4z~H0mBZ*憎Ս +EQMd*AuL2X^Kz"f]q: D!h,-vHchFk%M=fK:Z]WNJ7pd ][A؞uZ(n’GMȧvmTRMbָ4 x0fq{kYCy+!5> 9jY|a@ EΪTKO{}o`SF"\轉8K_r꽉o'4ِà=_-毪gjyjd㲃Qԫ]$N䀰<8?ډ2)BG9qTbin7VrvD鲙i9Jgeѝ.{%{rOݑ>ž`4Ԓ\ 5 ~KTl 1sYH@: Pdyf_5ӅMlz6('-Я`FDA+MTTOh^AFd=!2r2Xpv{BzDT$^ ʉ^3aI{Oh^nFz.xGQp57Sv:(:)đPU]y{ZHDL(H2vO%pQp;qL4W \BGdsO_vmR8t$Ottjj)k!cA)>=V|VasĜNȩ[ a!N O^6^4TTKkLöi>!UT{u,vTM lkB>stream 8 8 8 8 endstream endobj 128 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD  &.###&3')))'3>344443>;DDDDD;DDDDDDDDDDDDDDDDDDDDD465"  s!1AQ"2aq#3BRrCS$b%5T &'()*46789:DEFGHIJUVWXYZcdefghijstuvwxyzS9!1AQaq"R #$%&'()*23456789:BCDEFGHIJSTUVWXYZbcdefghijrstuvwxyz ?憞hӉ dm8%2/-lRqWP>}3FN֦545x3ȳ5-ap*StVZEH;#qWW>$*Sa큂FOfw)*/2++Bs&? OY 0(iAVE(. FcM3Բ;2ㅭtE EDZѶ My.ʏjRJ)۴\Ap.<26x3z08x,8dl8&h DQjY{j3'l:H5(!.IgDpսk$XdqLۑ}!o2F\z R b XA0,,` %DFF ` 5 D 4K4, h0A A`XA%V0H#AcdXA,,`F$h0@ 4K  ,`AcPF XA 0h",` FD"Fc,܀#EmIv/9pS?iBf+OZpQ쯶[5C/*>ҜWSmǵ&9IovLmکiiQq-6-vIvӝ/ᢈ1 :ǰS{WB87{̪ ;iJ۴[Kq+J5ot 1=afݫMcQlӢ3#?i9s6~qi[R읟H#;n}jUdigeK^A(" $aY %DQ0 $X Ac]M .$BCE\w6 F! MJyM$T4Nn L<2I(7n;w7C̮kqFZGny[h|RR9ŬhtZ2 ^Hs ̗cеѼ+ cϤ܍ &މf)-՚oYUoMeM3AՉ}DoyT=Fh\#46,s)1ba9Um OOx!xdu =8h{CR+)"퀞#Ο\b۩hѻ/] k.P-z4D4߼#X!sq4240:QKMp980OEGJDE0h$ڴ2KX A 4#XAK4 A ]cXA0Ac,` XF A  A 4!uX ,`D WAc 4!t Ac "@ԣW Zp/7e)HUB폠ar.PU2wr&hلqӐě$OO"鶥{FTZ{ WL F 3ip([jg29 ?0P*6cfxR0#]CX3*)$c0RGP \;ݍ=t%#6"ɕgՙMb^UUԤ\l8|MˍĕTLUmq{ǎ.-Q툷8{nL,z2DD# }nWneTm&Xda8j%܎2I(#A4G<{ap@υR+oV VG7.9cpsR&xUih޻ f&:KIۨJ4X\xUGHY2FRKJYIҺ֘+)^2 \Qnn@ѢbicK:Q pinnSRY 7{vUvOS5f\~ԃgS]ր,E.cK̓~AY.0\$EͅȐi%v a'jb a>z ^1p!hv;V*^{_D2=8FFY# {rFU,e{<"էWjqZubXÅ x\T;,lZm ב#J-6'D"FADc,` Q B"D DOM7-59ɕ ی-*rR q v1_%&9,m!z5ϔ 16u<6Zl6LMm^okLEtjJ窩tAwvC'0l:V1?[Wn6J3vU5C]O]2̗`n* Es|APJ& uLZ:pd䱶sl#O@C{ʣ250H#X XAK4YiĠttW^wPHR 8p9f/.pVV3P4H"`@n|ҕ^د8tC%"xlq}>uH<9QTC{cnWKmMSCKGU"hΌ.T3G&\ѳjXmXt -TI0b&!HsEI晰;UB *,fˊTgH6}ꏵL6d XU5Jj76hMwlܩ ɸ!%鶺żo"L87Ѽ;$y:}iJQwv {8|EuV?NKfe.5|1lwSOQdU~ahqύu5ZTZ/ [:q4IH% |)X$0Ah"F$0h"Ac$k >ՔWsj2aw+V aWG$:.Ȍ[jV\3*9dx#+sNFcRM׳%eǂ1p)?J[ins{5-;_<@@;;TZԒ `Ydhf$\KH≇2]G8^.J\(ҦGˣsx[Tu'(,n`k󅎼1JiŒpH)" !gjS] .31%N [ak0ʟ+cÅMȨtcȶR4cr:Vɭ \LZhC,4Ac#DEc A5!JB-69i܁$j3 H"a RERAHXD 5Q !:=yuWv{#x;6Ny`%*S5-tt[iګ:z*l'eŗKHMoJqKBANJGjW0Eױ ڟj<B'YZ퍹a`th\|^^rkF@&6u^ט`7|ӵ[TlKI&-#ٳ;a}R-hԨџh1 bY\K\1Ic=ȸ}jQ +=a^7U}9sX[:_',nAch쎽*3:t|-$@pЀ|J9OYƱ%;؞+5%, $ȻdR0Kvi$|QIZfC#Kܙ: C;=lrU*gy1(ۏ ӎpV ;S`X#+4OZ&ӈxnFDRp" m#n8F>FT;8ȋ` 6Jkp4#cqj4Pgّ֌h_Apq!"k7"x4 P `!tHL ,`  XA (5.{GF^Oo vEi~ʨ.zCYD{n/)D6&ܓ 00Bc&NB쎜{LZS7 8%*X(QgcEm bhxⅱ~-ȣF{(kƿoL,<3="ã7\s7 ӚwR6P3y,wVSOhNÂg*ޭ{v4htA@,  0#A +V)VBQH¡2mҚybHۚ_-3j V=5p*s˽RliN6Fq w- kB' 2qfsswUl3as+Aݹbb?i}=8y,{?jSָd1KiChmzPw\F,oÚM6_]P `&(Ӱ r gmE 27r-ȅ-2I0,`] #,0_~% BB tZýN!~ұl񦓱1 sC6ȠۧoqVmyќ7&pʫ;" XjVJ99`A X A0h"Ac,`    `0EYM9-!sj=;j/zM99p8=ObB8]= z1v&#])R׶Q8 aWFIQ;t9s6AX1X@9nM.xavmR:Ȣȃp|mTdO$j\mn_k|C쑌nܴMW8HF9$7s[[e(C?Q6ѫ>Yw+[oz<枟uy%}Q8Jfz:2Xq,R~Ì^ۮfWm f?(4$c Bkc#ϟWҡWR"it n ۝-K\,R3d)3y`n򩥎œ5MbWK$F8"ly= ['BLOnJs2%*[bHtrްYޞѰ-PA AXTl 0[A5K,XNKMCq[I 4H,`DcX5Yb9a%r}s2bIjdzsEoڬ Čd${*&gviY]u/\WNskq{hb%) 7 DD A 4H,`B cVQFd` QciCn*.{N@JC՜IkoM_t@zx[)*+mqU#<:8|92MS)e(nUUkDmQ$iG"܊ l1.Ɗ%!m,9E<,k3al'GdI@+la*N{1u,--hp&mf{RJMG\6)&3/[h:"W:M n*ITɛZ|lff״a"1 %b`AY`рd )V@d KZAJZMl셖4a:ãT$&X 揍<[Ãz}_%QS様^0 YX!;;no4"h߈9ZÈUG`4r;)ds-YZqNreS niAЪ,pxm '=_2}"iD,ūMfOE\ԯ ,@#cD)lWݾ1mOgXpO}MM&Ш4=د8tXl(rdSat*TFIB.xmwd&Y7zD۸[bxqUDm-,XC5dXhq hCK-I6IALlV״8Uomya:Tʓ0#D F AW>PAL7Th>(qpΉ,=-%3 3 @ B K2%-g%1D  4H0N{X.``cd:8s] ekZu~2r\LRn[0 q܎2!/xb.yC/{ p6pQ 'qos 9zFmYһUk.=P F 2=;Z괏4 }'OhrⳙۂG7*W6_e=B:~|FL=Á⃼FӖca)< SZFzhc]ami>x${fHtQE̖/zqeOd%9Ѳ9+.;J38 IFHٓMj]x? !V:ԕd-dh*B,`Ɓ6BVA` BR I+ Yc@VGdh h 5Y5O;@ $]P6yk,:tfeX /h{QG39_[p(SIr9%uCYpIN8STpӑ ~5eCzâs86qz/C]Vu9:m"Ǽ#8YLY[c8X}7"dQ+n{L8/k9һxQm:3 [?Z0gY[&iM/zh#)!j}Z5-=b(8 OR͘S)\AaCDAcXD XA10~}G2cKzS1/hHKa\5 4L6MKcя յhU VwLzqD~CVɮH}G2q\k|XTQXuѣzbL%л3d1kڝ\j[5o[b9FQVvXۢP6g^%g{sRi*UKC~|x3yL .qF!ӂ i5.rR>wmXBPlPai Iai؆g#qLD6٠\ LWh{t",a1Qg;GܵMl c:Kdw`ǕHw1:V6> ak=V*WL%nC4e,F^g -~.v`eL]!Kmq7o%ʊvLUgv6kX]v̎Fh=wj.^Vk jh,`c40L,` ^8!frRx$}&cK;Z%X ]&LnM3+kb!7.yyIK wakN09]c[b&YM# @M9JtrӟvÇMlzUsofHFLτ}3=9g̴8ap Ѝv@SNrn{GAN0y[q#[xj";qga[KR$ qDK`6%7 {Dno1NU;}"lMR=.d "<38rqan6_Q5b<3 Fcc uf`#ʘN8H:0&-8XE HT(u rvkOXt[DBo,ak.)Z4Ԥ[O{s]T7gg@[-흓 2XYht1IN=E*di+ ERk!HgD :ԧo,|uΗEc^xw6^ͨڮnI@}Alq nqԕS|~O,LAND.=='F4 ,`A #DD40H#Ac4#X nB;pp-pvW6f h/jKJf9jh˦kx4Nh|V-Gyc$Dpk*l#[-dlJw.Gְ{쉅QsW4;U^HkA>u Ny d\r {أw2z>9vUhviŬI&Эh?mE];)glgW#[Fo]<̦hn)H,-jKIn)OHr:Ψx~k*&ˍi*|!OW-[L.x}tJ:S)e=: PJ x΅M_֌ #2`&NS@qiLE ]ܟCJc< (ZX\H ]o~vrwy+p4H;?aV o"-Y22be7jOEG@wF}1iߘE*6ɻpOgO!rkoP{)ȆZ~dۣT;2t>UԹ׷ L<n` ,x7Z|BZ mt3KH`tfpHf F{d9C+gkIfd)&W #q[q(Nc4ش44檲f5Q6e-1GXfӒ7P_(8HǴ_gy(_ ]yL3@{Jlna8s Q#WlS^ pUɍε2{YE4SFy颒J&=E͊(V)̐G~zҲBZRMy-Jz b1UCQҘav2,Hr<u$*k6\rjլH ef-8_#5$zU$Efx %M~٩ |ҴPXTTkl͐v8&I-{qT1-E&skZ:j:(wh].H4mN yJJJ(uY Xn.4蛚j:q̟q5"?-=Ip}̭),^< S5XoNd*Zs+}bЎGpksc1i;*ʶt^2YYG$g<jY)Zn!GSX[uSqB 0H#D,`F h,`Gd,TKlWa;ظڃi^Qja/p.Mim=)k~Ejo,&I'oDxmZ ;N0fM4"zwkn5Ͻs*=md{d pK-04 nЋg -=Zn֞9uQU% } KUQLgG+ iD9W;'qrt'iN^ϗKv ad x̤j`_~`NܺO=gN5pvQ9WVUj4{+&;4Hslq \l(o.lt^Tl4I[cNf[#SVnd->q0sk&k+*<$;0;v2q,{U]I`t`c}i6ӱ+d[Ii #- JL%ι 9 |\:+=dvVp׻+CB"3iMWO M\_;**^"-!̧&.>duqi(Nxy8\'/o7"Q.Z`aC`.-kd;n`xےriALE=;4&ڞ$)M;R*Hu2i\ӞO+d%s9nIҒDsE6/ÐaKkcY -|C?dnA~uF.#+Q`G$ @J;U6s rU Hs̠X;<<IYhS vΣd ATm $F8al9]JQ[@׊z& dvny膑W [v. qUYKDA\~ҚLFF0rc-CI$+G鷷1 r)JyQ\)O"7!M;"F9IghCZ69lmDtv on)2gS8Fn'K<_cS5ԓQ5A@A ,`(A"讉h4IC5YDtĝm]1kDbZpK# (=LXu|S`}%3wS[-AC0! 9XX%=rF ) A u>7 >*e_ ӿW4TP)P%Ky:VMk@ =C#$t]b܈)a&980H'-橩_[fhQUxXS_N y%'|ʷm:fWB)rs9,5Mi4lHMn>@UUk"s{ɀ6h/o:'!ll9R;c1ꕷ\QDdžݷ&_}JdcwUTM5lزٯIѿv` T{R eE*uF+1 Z(8Mˀ+ZfI#]3h̕Ql^T: s9g (aw'0;%*)e=z2HիI3.4dtblmKA!$]VPIω 25sףSTK>r(6Mj36Icc;8') F\tԔPR'B;6d1]GD;^v2S"}EK cĕ6`O3k.NZ2bu8S7;Z>0+"ޟAFԐr4YѢHBG7X Z\1;9}|2ala֌"_hckW!G}yuC:`1chMdWQp:8MƙƋ\j@">cNa;[=ro$&:v)T$fwu'k)șD%vyW͜]6Fhh#7!|r+s#q8;2Mi H2ip*glU>Wy䂋(-CC[[VK)ϋtƗQS rytnٓG#l_Vp6K;VOO,M1 l'nJo b$4N%4H,`D0h"B4.%)!&yOEf873~ӭ8\i]jK@ڌ=x$[%OE+\k*]feܞ{ϡ8sd]`{ >N@ւXpv`EX[Ta;p5kClVnqP1::RZmpULy'yXvVhu1%[jٕ4U53Z:\:l% @qdr-!Ca" 60#a1cI!sP)i:𲩸nG- ;54tW2Ye^n5tXݠ=Z}Kc17+ 9J͕͂9Dmw\۾sߴ +\e}] ͦYW@民$V|wؚrך5PGtc`@5I4Jj8cxqnV9qTA D;6&IYۇG,*̪-_F4> L40fuqǼZ2#sEA:Yub74!r4ޑ3̤Uˌ-sIVM oq֭f QyM-ml{nf^VcaX?~3H춾g^NY.khmvsߐaZ4B8[mTsNJhCFM? IiљhxXn1Q.[D&;AͰsOo,4R6={dFE%-})`h̃]F؆ ދ.\XgTOG f\0>Ӫ4REmݕ=Au٣hr|DՁ4D$d3 8O{=zY23Bc,wSmv']6%B4\ EnO-r yV4Ys/bKCɌVtc6!EulǠzN)){Oi>CЃ@˕*k,x.5W춶Wqy82eYQ\z8! d6tP{]IfH$65Zқ wHKyvM#iW-LDLca Oq* X q@gLщʋkttl($ނf|ŭ,7psEB=:{_ {,>.ݸ)SɧS c#ǥ0⧕n"ةf]M v 4^ c:)r?գ kOȕ#߻AtEŎ4a ڇuexq%"CPL8t\~ Mڇǎhmp#Лǖ)tPE+&ɥ~*D3=yvq «H)[ց8`LUI[O;s;EWUs0aJ L/PF!Q(Fa.eeWA^M%NS4bjP-#4KD!dh,TLdpBMsX18?b~RQQY]1bŝ"]MU&S|{6vzh+V]9[Mw$RTsalz m膄 9C M/6#y6w`8zTM;p:X-L[UyDG;΀ ٢lbP4W Ai*)X湑狒r$zUq&f\>|VfxTy 7"V[s~=-s(fc7TO- Co!mKC䖎~a%ҨtlpÊ+[%w_ U2vE8e=5,L}뺎"(?hRQD-47S([VH%hkMAL2TFaωwޅ5C4k7.,b gm20p.jAщnl>DFdj18_|UvA$88cyv5*kNc)@錑667rn:X* :10߁Qi\cy[mO$.wn.zdzD-کm7UF PxkblNHc[aqv u-{I-wT&SYxwG_iDxNFCP;T[Bh)q}aSI#k!b'Yz]M0au'tkERo͒E*|_Sp_w8p4apu/7k_/2 sC"H w䛂' q9x+6{!Ns\^H&_027O~L;-5u$GU[6驺0]63̵ 9 bF18 %A19sIiZzr;w.Z-2ǩi۳Ìd:[~AIl5{Iq.u'EOv$;#Y(&m=۪OV197ԓ ZYR XqT;B֘nlMwfk6fUIdY@bu]=Xm3 1|gQg =#`gJ[7fҍ @m -g݈xV6[#ZʢՕ `Xq T05a|3Kik+3L7abQqmIIY`sCŧTOuQXӎܣu<XCǨwX6RCb2:Yeg$hF sy?ԨcΎ "LqD׎8"O|^}+:BvW;_3vL9ܲ穰CQtu{x۷%iCTd\ďrT4c0;ް#|:wͤ L{&i̵~@cZl{J:k.Fٮi0#jG5 k!'*:AWCn7ZeQYZ%]퓱]!pKQ'3/#^H6GSR[a~z +6kH\ zUv[0 ~n\z* }6hdArJkr`Fƙ īN0W]S4r)'>YGI~@jjeC -mR=,U[E.xgD K]krL=1 5E$kNRyGZl/gbر*2 rQ+Ѫ'tAnw@_v&=:`b_mpBv~ħuNkNV>y-7<{Aɀ{t/,YsdR4T`9:kk]Y\.Mn.kYm#bH>C(yo\5Ȫ+) 2Ag$b_Fcp ”' y20#2rk"ڠ$i HxE}$ (e΃R'N7l.XăCXRl7ȈB(nr f_Bbz&h1 [vFIY ﮆ@1G*9W9&)"#q۰,jV#-eC;]iQQ4&[=Wޓ~ U9#:06ǏkBv,6U[Jȝm[ (;R #\wp*ͨMn:;4UvF]V/ Hp8jcZ_.)DN!i,f|{,s(5sg8X$HR2]7qa}E{@`8mߝ*8<ÅZ/JNw8fl fe;Nb$\>V iUIM#) a&I tT@#jLb Vʇqpxe'|-kc@׊]T010bn}玩{W%0x䍒Ie-j-KIATLx Wr3Idz.i8598d֛dI1GfI1ňrppXTՉa}ͭS9x{\7ˀ=؞זkURTB' ׽# <`ytO(.,fa);hNvYI!k]O<8o!7☆r$&0n VR͔޸ ~ڒH"ôrP-?6n[R]Fr'BMekL縒0dDv᥯6[O#q,8dGJoDBrRv}#!奷f*#as/ ;jJ$KuH*lϘkXƀ].~}A5237pD׹.sL"x7=72wgx l:U.C=淲#mR0;4f5򶈶|mV洖@:h|ixn|-+WW2gR[l,7l`%~~L5Xp<_DUNpɞw聠 s* /n& GV5k۲KD5E ^0ܓmQmgG̵ SnYwˆc%iz)+ R剒teoǸ 9u.9W]6U"ų_Y[$I{t/ٛ86X=ؽNg̎:X]1؜3+dfydv7`_4>!!M1Q#~JBB*y26Hs6SODe$7W)}7E;n/0j"66<,W9u;gE6w8\ jQ4Ϝ{ZѲOJ 2'<tLT٥'39[Y-UT-Xgj]8GUJbpq z L |-aMF7 DwdwAF)=K& |F̋4~}j7#aqV:?s(#m:WAjމ=䁧aeN/6E LH=| ^ ڻG݂L-%S#cF+rfյǫ+A!dL͝vtN=[nVPOp vhVkZǺX7c#NvQZ[|l{88zº램ek pr9Rz)waqxU$E-=@1ǍSayikav{Ƈn= |5$gK-s3 t@O9b%̅hasޢy$13n֑_Tp|nZ;ޒwº2+bILnZ׆5[Rj66tfn ʲlL&٣ {4.zӿ~3!"FʀBU tF{lp3@<Үj:qsksmʭuk)4[9b$iVCrU'ZBn/_%Y٪/Q=bYW CZ8(CiO$ŀ;Eu;ЌXoj{Bn]Ct^o\&{ӵ4j^]AG5k1 @kRlZv8lNӠQ+v= fe4,`ʥTK[UtC*PrmQ_;C@6ZexE]X㍾H𫥊"qn -x,$ ! oٽqʁӨctD+h2k>LQT,nm*!ɪ.}Cf89d$&:;Ԅs_v7UqJrA\^sZ$gaؚ{nVXx<2M\ S @qԳ2k0qkkP1;tˈ kii$hq#cAh"v}% Fd>H])_[ކОm/99 &[$np3 jėtO {͜q$ly&6FcΝhSѸ7{soe7Wq"/=pGR}T~(pHЀ _gОpTeyC`Yc{Xb'f+gld,MSYPpQX4{㌰bl(\ CG~TL;D۶7g#}A qq PPYKNHὮ/cԉ_ 0Y NF /ksUXz.h UWCMQ3x]Ñ̪&c* ̉neܟsi`d ~v&ZQ#sq,zھꌕ4UPׇ\pjaF.9_Q%6Exd1;ltDU]Maf}FSel3^7lC1vʇFYҲBB摙B9ƆjHRbcSRJ˶8DBUt衖sɂ \Iբx l8qacoqruwLmI A s1:&F6|h9/춷Yc'Z-f{\S{;˪*D=\hZT9tsMVXKd\32FjUm }@$7l X=ϑnj;=}%]VVlHۺN|3L*MD!ٰ(͒+D94ݭUU=ENwc.>*;FKxlauiDdRs97hpӡKpI֛o$F 1o63!iQaxVTU! HJ#6|UCm n ]m6ϙ= kAs*USIۻ v5OQ-UC;9vv#dΕ7x$;1sFd rH=p$bQƏl[=aq7>* }n!r726 |now]6 7J{ й[rd0SM\]dPPl.]fgOsJۛVBD,7^3yxhd' AW6U/ xf f<#ri͕B TQgs*ʮ̞Y x&gdaaB%je^؍bS ,9'q(h h .xfAVtı~n>+%lbwHtVS \ˇo9uU|NXOJ獍35Dֻ~X#$Me\z ?(&+YG#'{E([1ק6[a[["@)1]GxI~mk 6!ȋ,eq,+E3J+LOϸbc1F!2GE hG䣪GCeS>\$0bhݑE#)G),m.2Z#8:HcÖ· cis_Á6`Pɩb#$;fqZ5 K%CΚ4Đ-9oe|nؤ8މ,aێV{xФ8$> \#p=YXGGXo"j[{l7c֊7a{\t4X$9\[ђsF)4 s 54nd[%,i'MSO J6 Irӑ*붎 i豣WE_* 7|i o5e6ƦdM8C5S }vZsFt\ۘl [nB4A5P+p6N [M"4g:/A##O; iH=21(po0k=]IȣJv.lݟ=y1B:!^3`BYT#%+b!u؉SCpPpYG-JI3<6!7=H#4ti|ܪ1I$t/6a%DVZ߉Qfw0ͱ;0TJ:[rb㐷yMEP|jcE'DvЖX]c}Di8*JR kEBhW3;G|%.s$ܧ*縸$0کbH,_ iN4Gja)pQfNj7`NRe40a6H;zQdx 3B_U5I@8ZĄ}&pb'uk+j-#>QVCCsĭjҳ~!PPMU- cO#.$4mwwy أPG3@ĹI7)Rv,RʅVFY*A' viCwI% $g r)Ҥf1Y*3A~]ħD^ov‘#qN:60z$쉌,hЄrFS$!_3z mڵMЀ(GLGbLtN„eZz~z餁HЗ_Akح(󍝭^r;SRL27Obpp kI/ ܛ.Z3Єețb ꕨhn!%Hqtl%4mh}IA:Ep@{J^$15hp} JN. ddol\zC$XmSۄP ppĝ41p 85:[8w28^ n()i6'8|5*Իآax%,bǕƔ;Xf]M4z2'gRO8:15p'G7ddMͷEARW";i$y\FM7G]~5:GA ؋,$)DJZ#71lP ηD,$FIݧ$R.hnDC1TRѝlaG%FKmrxlD|"G]i0cN;vHL`qo{3MbKSOpq8XI<XXXҍrz.Δog $cM\Qu0Jbk|dTm X|0m&ČFY#yx#B؞H<7PT9&: 6;|Oc"aÕFvJoԇ𳅽i\C_,dHOTn a-B:*gugN~ ǍZm)⥥;h8"GIIII`I=&ΖwLuL[Ґfʖ452t=tk"X7:,V*M:=lG1~, ڸI 55é'2|/t*Q"q5i-&%[ZW1Mq MR4d#Og uX:'yUI2n5MϴcLTE]nlH[) D7eg=ᔡv:MBHo),{{:dS8I9i6 8ɢޔd腳60faaBHJ]VۢoxC]3Bj:*T/qϐќ_<Hu$~yETLv&d3j}.ɧ f@؋8J ٬oT z3#wpGq E 5-hF9EfK'/ȹʙ_W ;l}n {KkOR,%^,#ҎBLNUR#ٸq #l4tSZqXppERsa)! W֏L͊ FI:RnĚ ' MͫM41.=i0FuXT^뿃nOcFvUTu dG_֕,57qicun'59qok/[OIqfd&f5P-hĒNڨXZ(,V:-]%ڞ # #;wIk3cY75cݞ#4aYEʼnAUUrsdsq [`p GgfqQS& Z_ .׳-U\jF0tBtjUHX+2V 5/{9 ZŲTl_1dgӎNGCNHkN\\L1!HNuŞ+)&ˡ2= `4d2)d$ |Wmꉤ&Zt(6˳eїfލiÑqZdQx-mJDOkdqsq2x4˘v)▞RcT\N6@spظ\f|,̢$3>7 X\}h\B[IK Ȏ6 [7Έor- X%[ؠ첒֡eP2Mg$-xײruMB{SKcClȔpN $8y{c<͙:V5H|nrHe4K#x ꍠeQJFtKS\`oF1 r{]to=ch\잦v{yai9-pdb#V֯ (hOWl7 l1>qko:j'3= mq ]νT 9?6ۃgα,K/L4m$=27z.$$OZkd|ЇОu G5 6B"L_%8ص 9}gFx͏rtebNÊG -um7헲$Zwjt!Q$7;ͬ-Gam,`s6\R$2F]T궓̓8(8Gfym\.n80[a]Aa<\t<=+(Z"m'ifCq=eĒCG=dr $c=9,6 ڊ+JFwt{ ͹w&x~jdrh;MDIR%7sjf eibÇ;ʸ#6y+y+|ml0 ,`$nqr[,4 _{xJ2lxކG_RmEiZzn&/XQS,9{+ڀӇh ~T9e` snvnBɖlJɷ% ҭg~٘J۳WL))[xɶ@ܣċ-mH$[>M{#EnmMD]UXo# vlo}*Nk:9e>uS F*@ܲ |SG+s3&.})(6<I)4ZB m*aKKg@FnaE驀ڧ H-mX_MIІb~@VUۦ%O_Ehhkf=+@Kܛww( E7VԻZxԻ++;f{X*G]@]̡m$kap(4l㊑ȷc)Ou-j+dkz,(Beg81.8$;j -3 P#.,cqqWAwkm7Ji#18;[vhI%VrhC ז -%Rr|7.(kuMFQfǏb7h_T\MSj+|& PI#2msG5]gSִZS5"N]aɢ$2<̔ȝ1-]@`;T%%?\?O[d{A4tx'#x*OskAqѳgA;A66]ie'K5d9IPGWFTUaExKjIS(`biq*;޺:G_#63 F`N$n T:Ms30:gw?a6>+36Q'U C+Z>XMMc BHl'&!2a?*6;+#8݌xRNsނC{ Xpͮ^Rx,ϷB- r{މGPE㙾c]/3Oig$'>p(^-8ƔPhqXцnlpN61%=Gɒ"H̃p/[+~K$h|h2:aJ,cnҸu cHX H%R!91f䨝wn~(n;´[X+NgݻWg6S8F=DpKŮȍ V׉CAlMwfΆW6iAMhx51{̇4Ӑ  aS7z>d>7Sl`Ybٻ=d6F:@մ2ձ\QbɠrԪaZ]rf_ ݧ^c``,i-84ͣ5G*eàN< ᑢ ΋`6Ʀ#oH4U _AjvEf^ޥM5 -6'LJf- E sI.jUݘԳLY"}Qy=nFMlpɵ.ªF=dm9KelȠhl I$b'Q 3l'c^|丛 ʗ048󧥧ks)~3W;sÃ~iRl4Z*pxZr vrQkv85ڂ \ SMU;\)z?"F|rXf=jiE6LP1;TFy7:ῂorHk„*MHWi+{ї5M+0<X Cka{pW[CoGAl0U@䦺FHdPU;;1MÉךM#uŧ g98MM8Y݅? $'G/8`8 !܊~5 ȴgV{99wA$1fqВռu"R6,C>%{JCHvROgbv UY9Vqaʊ^HjD7HjauVj QNs}xYg/ڀC/dE7SqKD6ǽK <^8#z'̕v\Jjf[I?Bi(`ŦCԊ, H]P,wkX\UM\xn5HڵP[TeRrWv ^A&tmu8DΓ\ oRt񵏂9zMl~ͮgB0da ~ߠ5Ri:qw\iR6~Ȫ98A.p#s+s=6\1't'1t@aصG\A mU^Wu1n@tu|,snl۷\U69VFn.9&'QdOS:ae?g:Jӵnͳm؅`)sΜkaG^gwyӓJlh>JʈZq 5|AI3HM'a:IoN;v$Zb;:Na2CHCXSmSҘ#sr5P1 =[Dt2m9i.7pO4@$B9C}nM(gdN&D7lO~H۶G5 #غf p3๩!em&&֗ \,riU%TN68WڼuQ,*LgG]trtt uX5"ci+tpXk0G$|CPc;2DuAA1aWXr\`N}Q{TDH]$1XHp ߡN7^l(@M,T F 8K2 \:*(ʆGc> :d25ajJgg0M5 F N4rU6^~UTs ջaG~U_=<8ݍfA%WP͹X8./ܥm ʚ1T?D ,)ḿIw2A!U(sfUJ#Kf;'hWKw:Xd= AV 6q=Hgf}θO,܋,J6iKJI;IlZCٔGd%Ѹ2:䀖-Z8L2IˉWqzRH$;tny)ѱ\2/4L= ;dDp%\d 9(rh.GN3 Oorz[MʣKQnc{OMj(%~uԌ,Z KjY *?v8_B'%TM0{1]lu]tJ\\wl+>K2KEM,k#iqsfR]v$k_"2e#M F)dچVm#d̂=԰pw=K$.;r"6Nq,y;$pKAQ)?L<$L/=0ppK[2afZN'\BѬgpF G:58gnZ.[#8EsHqT#iex]SQ Þv:`eVG6qHQliM}L]H$  eD=]KLi'lsFc ԁUQ 4% 3sC\1 [H - aeMk-x_ d4t68 <6ёxɍԔͥ^%E[̦cecG iq橧mR0g:=,ѝo[{ۡRb8<əA*YJgpZB=2X\1SXlSZk$OzD@q ۼ #LM jl#q69:oRy7xƫjҸG`mؚj!Q9RhDnǯ. 16ޥ :C KnF~;@gnWD|Ftt"/5u"(#n - ݻ^C^C'IM};ᔇ m6 :UIH.gE[eK.JҬcZdZ8l*zs7އW#sDC$JGa7xP-ӎ`T=uEdRnDrj-U%6%-xUFYwe$::h6|?7BC"WX?/>D%tPFЉ.&顴FbO[";FzdZ4-Sd꒜a,TI =1"2Ahrvc|g88KH ےI;)z'|O[C3v(1.>b2d*C\э.dQ g MܛnCLH#}bZ֍\csDBDZKMWR6&2y.&U^jlnq ^)EpNZg`ou(cV; *[!d4ČԖs1klPvS@ʇJnGatU>!#"ޔn Mଭ'=K | r6$eƭ$ G$4 -&6d,;Xf {C#s\]cUS<ĩ1SKOD?gb|Ra .e5\8 K1fSu GI#Pf yiOӆUWg v7ɥ FJYo*̠ Ӯ(}r>K?lK2H0߮[9M}#]s|^m(x9')p;ЎdlM8X|tG~E=mW`!h hFJ9<@SFi7]`u;fX|bJ}L 'jFRϹ| crnл%/b>Dxxſ"ۆ8o`⥘$,6$ᶙ.0ɢ4eyi"ۀ91 7e!ٺ63?"V11Ip7QwncG8I\a`y>%j9QsHps@/ê9 a%h 8*^h_U#MczNjħ\ ) Oi!atLQ 61dzwZ lN qR)4͑ב^ Ts CZlƋ3&k|R+V᰽ǘ0K<GmӓgG'hΣ=L&̐s$GNbnc[=S퍭 xX*m k iLQ9Xj0dysKGER #k%ty®(PKvXp䙚GeН \vdjvC␶GO~<HDfe/s sO2NrV5[LW#0F{ ZS'93l\C}tOBuOӶWb؞b 2:5]칱fPEtkq5 ِ̩0>H=]gXKxC ]omS=eML]&7|/nxk9%yLխ$buNʧ r`gu9hㅑ%4 .k-YHeFqT7K邊[l #]ְ}#mavVzukY}=P ~\1A0vØI3l8fTLZ.}c' 3 ˒@{X7=- X,NG}<٭W'rI|p@>5)東;,J'yLc`>l V4-6RM#bnlcseDQv|ŗC-Aɭ vVTT<m $(+DM$_/6=ܒ-: ]ӂ[s1VZrZZ9d$44[ZG7سC<_ orn])Ȯ0 I Z4)Ny+ gAkTHAs4짊Jo{*=;lo4x,aIDZ|ϼ @!:9x mJH~TFV,mcu,Jȃ,֒,{A \K+dAi΢JExodq=`/'6f2)/MddM06؞.ۻ>WC) IkEݑe}:ܦ"飒i9,'^b׹$uEV7akǁ־FG00I|E1Ա#\S& ݉[WR7'T( 0ꧾ,-m %vP;D7$#Xl u-1]@v5i޸r.Kfԁ5k:-\S'| iT,.t8p*k|/ȺK8GVy&YEH˛Y l; vlCBg<jZvS{4ҵ> <:jNڈK |xHp=XnմcItT?}|h>8!-TkV{EX 2.=$|E-RpKٔK60 D^_Rg؅INIӛ{ܢ_Iq7%ԦSWPp3r&cq<.Y%nesy ϰi:"Fq 3\ń9IeeV EV݋y &Kuq\gZD˛`s(uM8̊.+}EHtc%Ǎ$Mr3iv dqGCXfN.6uƗt 6mQ:ij&n_] tHuu zhX Z٧ jjgHEtY(:,b&Ѿ[\AOk{f,Ԧa܆,.8 G$C؈Hw Y-&ݨŎaM F"J |V0%dn2@tԀ "V1Nvcmh78ݰah N64nJw9v*; 0s$kKlK^ d$Bf>N a]ExpI{ 0;)`%gv8gua)s.fUH\BYuyqFMydߡ'?'bA *aPHl7?*ӡ C[v_C`W}.Ic5^4 vn3Zp4%6 K\4 ;UD]Z-?i8񴸛XOĤ]!!o>%$l7s+tݓZKA1mArRŇG )o4Ѻ.pn긟wȹp1{#\[+`E%$ĽͰHr}ە6F+]iHf3a<صi8%LJơ_n{BX.Ioal#>Tln$ٗ*zv-!$l4q5G#&-uZqܸا CCM`81'.NvW!^#lPNEv'h08$\x(͚C|}sGU%CZCxd 96kx2EcsC FvɫN+0X]νw[n].L];Ჶ CAW> \Ւ)#&4;hVa\n.s sENVI*Eja"}Ic#E-xԗ`H<8" %0CA& ;: hO^ih7Rrml!]#n,R>Gh|҉Yb .vjl;(sKȦX2yB d/ mꤸXrXDrF2$}RFckFަ19>L`pA٧MPz";4@9pHZDXcݹh4viA @ZcMч\$4VXnI%ײqX ѳrE) [|0ܯlb XPT 'pn8%A\1o};(919ꊓ8-qSFIH˱@"wG|2i)Mdժl1W7sbtROOoOw̗)c+ ;[(+dPӉ O2jFD5@-P21Ҽ=H]"0 2Fc\ֶMqR䷲;l(K{.>tdԸ ?\AK|uA1# ;,7J 'TRxA)e|YvYPSRR4nEFo6Ip @Y:<6#-fӘFj(T@#KM#0~.HBc~d8ߙj[% Hǟxbͮ!7^O)aQSFc0֟h#dͲ\hbQqk~ a`o؏(M^!ЍQKJ,DL `| nW- 14if&}Diȶ mevxwL y3ȝELAH: 1.ٔOF OFaާ !ĆF"JM#4vt;.ߙJ p'@$:`A Ԋh"y簓ne?#niDlQkM~R8O]a FMOld] h;ZYvn4(ٱemMx{6#$БBCF 0RHU;NG,%ŧ,Mm!]V-cHYݤVo[X)qsxSn"+IDG#*hF.J4f $46ӱ#˳E|ZM,~ϩ-nGP>|uµh#,4Sl "-GʭBd-&e#}.>U Smg?vp(le=lpJrL]pB"I 26p3i3#&6]`Y$s3gNW@+dYFӛHAAkW ,h Gm܅^T:(OxT7y#,'GaqD9%hW3c8A$gߤcc` JKA}C-`7;NI WLwzEy56&<'iO #m` ⊘B],.r= .)-0jsk"q~+l"K y|emnH3 *^{,Yd1U Q@Ԑ2c NݲVsRMryV+< <Q1Zj>X}?:|-7!ޓp(T{+Z?Qm~u`i{܋ ni a7ΏpLrՈ{mn(k7 \>OeUIxrZ"y{ 9>VM)mvEj>FkOՠuV,b~t+ẓ~uqdiqh&Shbxp4B\-I4V9371HR2Z1#E wuHF:XY:X!."D7WЭi#ް }I.LZ-&(uUݟ?ȍ$]vI(A"(1R?9D(aT(/X2S {1,RJ1{'ێ*lT95:|jYk# uB5IY$dnMt%ks{󩅮HcX!cpԃ!fTQ NE>ıiGp@/A5B ]o$255mm,9/owGrV?zD(E'Z^cP7y gz7R#7l=Ztm`[¤dx wcِi  KG/A֘vn\ݣ;x."f{4mCiao.EBTȈ]q9螂̉ZK&vF %rR5ȃ[M>tw9ax9q7΁)Gq-]PH_ p|ȟ_%}l_{ϊI-]Qhk $y|fPD*b }$+%?I>e$Dut|L߹,p'yۉ"&dmB'x8FQI9P7ъ-Ż>u,D1 ˚<ߍt sm.|fD {\~pAb`}%%H!pq̫ۯqQ"K&X ֖aj#_#0pq9sN2zW|>tda"0J斀[|c R'@RX/;RXqXJmM9n<cvtMm܁[Zo| dKT}ԍ![>=< 7T}ۼ:lVS=92=܀%7{GwΔcR] cMOc~IYL>:TPNƁgwSʚgi:6I@k/O~x["HbAbdc!]`t:t2 ,A>z[Ht)ƎacV4F%\9nCv:mZw~!D40vGHD[C aX"% ,r>4y&}Q{-G\kiMc$d.-03˚=g5rs.vZL(!\=%9oD6ޔYm}hC>^76i≆k;2 ȋY;Qg" hpFEO>ko 9fag 48t lhV0#sGlє,9v6ȅ|8Gb0YH %IG(T#wu2Nټyѿ!0;z\Q6? M=E(a29;q(Ն9g_\OJ Bz?~>&IiRD}Ηԧ݁E:RlBpKۗ܇ʈQ!2)56VqegݏsC9bJo 9 r`sF.y_i|[^4h$h}(;'CϘGy⁾YSӌ9wXy @KF?ԟp_7ޜlpL1.!IɎ$HA̓?d͏I9\#؄v.(3+tM|ރ[L5I: Ge<\; {"ifA* %7J/z8R/LM`2se7hR~}Py_1@CXJ.+z:ihLǓF4kആ!ˌ2V!3Kl0_.δ@)m{ۚj=rVa%Gk<:{ȌZ-#9l|n~ wGfgceElŅTǁ-6u4DەSȻ>#rn2@DoyVhHhí _1 7۷WO|{ZSAƸt1i*ۼ(9b[N3- ')xp~|H4tiZJӝGG:TR:aewʴ=*t[F4~T4d[HluɬMv|TY"{]~V$ -:!Pp!~*R|XʄԘ[yA%΁6\1Z0T팷h#N*hՇαpLؤI`KXp2OVbs-:z8xo%8xYT?>č:wx[E4bP+lآB;H> U),ǎ(UM P蔛54ݷ΋iKpV@HЖ7i,y-im=~B-^f́-EA *8a'M"bFomr-$ZVBƸED2dIFơ|&0?К`fL2(;4Y8gR[Q.Th_s#9钓Ch f2 L.`n.ᠷSyYZ[m, 66K0en\Jl:Dn` XPm v6Cu< zk4헝xM3Џ HdH~Kwʇ{C#Eg4rM$QҌ1;w ⢘ ;IiHm Oc3Le;ƴ4]Lߪ 4NxMnA6֚ ߬>/'>} Q|Qn~T љ 1'FM"&d:L%k0RD\Z:ݼ|v[Rn"ϱ9 q܎QyR Z8`ߝ=΅Y`"N(8"T*M;9rAzSLtB{s΀G haѴf$A)t1jˣ'OĞ&b3󥈤ۿ֩# 8dK΍TNu-?q1}8tF)ɾ΋0ɾna@>|:2ڝw[XÎ2uݢX@mC]mphg>ojn iӹͰs坚N7ěZц՜| v%1Z37΀5IG472KYWs3|!c1oMZVFVGP^ۯ+&$CvA|?g}MI兤[tѤtX̤Aw7Cb67hTU%4k\Kr!-"p7n%yEHi =uM =h\t!-求TUT,0PJ$-l0OwAn&YjI/#;%aN@EyXÆ,> . $d HDf^ԓ 򡽓Zw$0/u'/J9zP3= ѡҙS]O XnNӆgq1SSr/P,|tr󥔓IބsjXe, W%\M!>tD5+4a$RJ6 Hڅ"Rer\V 9$ٗd@4W#Jua'׻޴kə?&g2=_:0b7G"W0\F4̵Qvir(Z 2i%2Zn}P 5䭽۩F/KI:vvhdpy'DΨAK x'JO@#;ꈀM:Xۍ t8T,0Vaխ>`cnq[uja&IweGW)g- L0`msŴ_֌BOAF 5]%¨~U'Hz MK2Cm)oO)6č)a9kCUzl0a;V&*,z̘V894 2 #tG`fF|)Ni)h+ELsC Z$sNB;8,a$"( x4XD$|mW4uJ⁁d$ >/Filter/CCITTFaxDecode/Height 321/ImageMask true/Intent/RelativeColorimetric/Length 1627/Name/X/Subtype/Image/Type/XObject/Width 588>>stream YNpΈޝ1?#?ʅ9#H5tc#pp0V x~R xv*@ !8\+y!2Â$"vlmp< ! w+g\vCHrC( ޿A 40U$I$l?NA&S+ l;kT 4H$aja$g_aIϲBMޯ#@I`2 n.1_A$ MT_ Ih'väH$aޠL0i3;JiSzB $hmzJ{KI ai0$i?o|$I *I5I& 4I!oZA$aK% 'KiH0h$P/wI T*I$l4֒wIaߠI0 $`I 0 ~$ۥ$a XMUMA+MJA$l6Y<X6  tַ pH 0P` h+iB|2~ a/UXdGBaE$6KCH& ,xH 6a& MkP$ۥ $mA2o U6›F $l?dI9c9g&9Ceai H6oAmv anl6mݰ zö6gm_mK~mimkw_ K6h/ݠk2pM[K is28il#@&ߐ$r[sv 2o֫w %_a i]=}IJ 3I/v{H0/ݥm_ A}*&u~ r evU; Wdݴu;ooY _ 6 6޳am￿a}}5P m}0Ez}sD ah(i<1&uj ]l4Knah,wGA6.;[$ Aa?G0=,08 YK}p++ar@}(V%^#$sBKYAg qqL6uadtr<+?a0>(xoa=k$9Dbg8këngiAn۽(<$t+m _@à IkiZ^ Vսx_Kl06nvګ\BL G  4m"l6vI#7vؾ݆x  vP aGAm/0(3]l6)6`}L,mmm )-ݷYn` %mݺKe Gm۶G+l6lVݷj vvPl6wP 2]jL6+PA#:=҅km+i[JJCXQ endstream endobj 130 0 obj <> endobj 131 0 obj <> endobj 132 0 obj <> endobj 133 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/Rotate 0/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 134 0 obj <>stream HWnH}W iE z3+yX/m%1IEM|Vu7/Ilٗ:Y+3 a~sy]pUOO.?0yͽ88_N/J@,0/'gtq~>ۯ#XwDh׶[vkN)Hi HDd"f+3e!=N97n8I$ApVLfOq!>0GB ҝ6+FÇCfzAmz*pk8weQܱn(NG3q X|Іv;jg5kzZb<$~oLTUM®a cC*_nEr{^]jz z=l@Q]q*ŤYky# S,4,w.^645t=ceAM,RW.E >>&+ 薛^zjٷ(C+L/nQ*@}QFaf)~es4kU C0_ڜSD܌Qz6 D,|yb6dx)=sJ}dA#~WЂ.(?Xܗ7Xd gmtjKl"{ڗwzGhw:6 " bD}英Hq}olVV 6PAPgd>K/ O}ZsчԘڥmXU㪮I\Gj-8G9/ yah]RgWq0{,'GcD4oS(@[H_f㋞P) ZK{[j6]x{h$#+jOE2Wb=ɛ+q m_K享)q YUxo]!`ϩ vS;_GxTDt[:6c)6Q1Nc`U$r$yAa]Ic>7ZٻK-.Vkf6j0-zEn#a zu&oj3ͫaȯ^~ o$ "hh 6@h74Tl5`f63qlbn0%p{6ps;Zu2Dܙ4mWí]o% 샠1H <-HL5$7-Q+Pʲm c=оq7ϨRâM+hFO{gt8.z:$qNO-7(i9 V#1ߨ|jz;l(5x9䖣 {Sk2k` oyZ,hV#m&ZRh2kHhW03lmEVym[;rЋys:Yo Fڠo= :ﮯ[/$rjB.{Ǡ|5?SPNw[QQQKM2r[jGobb>r'%2;JD[ {G }t3_7 lWo3tqt #4oۇx7i*նoc#U8|S0?=ׅ5UӚCww4Vcgb')j>ٌ^46"/t>UUs{̄9*DŶq(V $Ry7ю;m?d`70Nhzx`X܈?`*VK_ӇmIQŢV!D->MS|U+, 5'P%Zp= ;uY/xa(OU(Z[T/ӕ{֪g4-i98TvkW_fVn.KWO1)!MY< xށx( Y,%MdG@P2dw%ALp e giv9Yz{% g,SQf!˥Z"A#2b!#YbDp?cpd(D bK#cCɐc;9Jч=FY(2K]yKyN/N|;!di*J72g4EJ"), )1MPIo,P$bE2 txGۖhsMqt)}O)%јzK׼ Z}W endstream endobj 135 0 obj [0.0 0.0 0.0] endobj 136 0 obj <> endobj 137 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD? t yQa !"#$%&'()*123456789:ABCDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz?iGB,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2:h^: n XBR, , , , , , , , , , , , Mav`bvG=TG7N;&g[b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.b阺f.gJ3lH1<9#pq;5;/*,nBH 6g\U1uBL֙ 2Zd.]i!uBL֙ 2Zd.]i!uBL֙ 2Zd.]i!uBL֙ 2Zd.]i!uBL֙ 2Zd.]i!uBL֙ 2Zd.]izpɤlx18p;69]#`nkHN^^ /]`X`X`X`X`X`X`X`X`X`X`X`Xх Ěw MG?;(4Mvr ACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAG͂t-%wpH?;Α8/r z0g3Wp:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α8.G/ݞvxs%np:K.w#;Α+9"vr`Uc1f3c1f3c1f3c1f3c1f3c1f3aWIu4Gi;: }"noH{G+jZjZjZjZjZjZjZjZjZjZjZjZja&i'wpJDx8n;.''|w]9yRLK2e/4^i)yRLK2e/4^i)yRLK2e/4^i)yRLK2e/4^i)yRLK2e/4^i)yRLK2e/4^iz0K>wqHǍM0ݷ=x5waϋIfqzK_39|_39|_39|_39|_39|_39|_39|_39|_39|_39|_39|_39|_35^wgIX×IxRacv0?=Tzp 1< ;:HSI9r/5^k)yR\Kr/5^k)yR\Kr/5^k)yR\Kr/5^k)yR\Kr/5^k)yR\Kr/5^k)yR\KrNwo Iݬ9|91XOE^:үU0aTԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-KRԵ-]+#\7OMj3c:c:c:c:c:c:c:c:c:c:c:c:cc1 endstream endobj 138 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = 6 ˛+i;'g@P1n-"zQ[uM!iC~/M( endstream endobj 139 0 obj <> endobj 140 0 obj <> endobj 141 0 obj [0.0 0.0 0.0] endobj 142 0 obj <> endobj 143 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD@ t Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?g]]]@4 @4 @4 @4 @4 @4 @4 @4 @4 @4 @4 @4 @44]3:f:j;2^ML~֝lKı,Kı,Kı,Kı,Kı,Kı,Kı,Kı,Kı,Kı,Kı,Kı,Kn=\W%۫:<:6FFwg{:˩u[v`].l v`].l v`].l v`].l v`].l v`].l5c`ʏ×|o3xr;^|Gdg{γqdFԋu]p.\ u]p.\ u]p.\ u]p.\ u]p.\ u]p.\ X>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 = $dx"R')fIu|EJxPgo| *o 0/r$ endstream endobj 145 0 obj <> endobj 146 0 obj <> endobj 147 0 obj [0.0 0.0 0.0] endobj 148 0 obj <> endobj 149 0 obj <>stream AdobedC!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD@ x Aa1 !"#$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?`X, `X, `X, `X, `X, `X, `X,_|>_:=MSA穭5r\%r\%r\%r\%r\%r\%r\%r\%r\%r\%r\%r\%r֞:׫uu#>uGCCbk[GX{#dda0l6F# da0l6F# da0l6F# da0l6F# da0l6F# da0l6F# '|=e>ӥ|?<^ G/Zعγsu9:1{u"ar0\.F# ar0\.F# ar0\.F# ar0\.F# ar0\.F# ar0\.F# 'N6N.`k46.ժ<\oQk.>;=gYst5SXa0|>F#a0|>F#a0|>F#a0|>F#a0|>F#a0|>F#KX5^֝do`\q/=^mN6mS[|Et]Et]Et]Et]Et]Et]Et]Et]Et]Et]Et]Etmw[u%hn_u=fjmN.5Ga9:/+%dY,K%dY,K%dY,K%dY,K%dY,K%dY,^Z..jmnVdUk.=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=f#Qţ(u#EI]lYut*uI=fjN.5]kzNFhZ-EhZ-EhZ-EhZ-EhZ-EhZ-E:[Yu다=^mN6qǿS]y^z^z^z^z^z^z^z^z^z^z^z^z\mw\uimn_~<_<\oU4}savZμhk~8Ff#3fb31Ff#3fb31Ff#3fb31Ff#3fb31Ff#3fb31Ff#3fb31tfkβFuzjO<^ W+Z9νsu 2{u%ffb1YVf+3fb1YVf+3fb1YVf+3fb1YVf+3fb1YVf+3fb1YVf+3+7NNn.#b4..Ӫ>uWCO`hkG_{u$ffb31Ff#3fb31Ff#3fb31Ff#3fb31Ff#3fb31Ff#3fb31Ff#3ՑJFoVKIxj>_:=M'S\yk////////////㫮uuǯWM᫪xbؾm6el[-el[-el[-el[-el[-el[-oE endstream endobj 150 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H1 0 = ߟH]GNEʛ-e١#5Ü+>dWn'C#i[cHYtdW?a endstream endobj 151 0 obj <> endobj 152 0 obj <> endobj 153 0 obj <> endobj 154 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ endstream endobj 155 0 obj <> endobj 156 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ endstream endobj 157 0 obj <> endobj 158 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@G endstream endobj 159 0 obj <>stream endstream endobj 160 0 obj <>stream Adobed!!##!,##!.333.!>BBBB>DDDDDDDDDDDDDDD"!"!# #$$# #$$$$$$$,,,,,,44444====DDDDDD"!"!# #$$# #$$$$$$$,,,,,,44444====DDDDDD8"   o!1AQ"aq2#BRb$Sr3s 5%&'()*46789:CDEFGHIJTUVWXYZcdefghijtuvwxyz!1AQaq"2rB #$%&'()*3456789:CDEFGHIJRSTUVWXYZbcdefghijstuvwxyz ?u#љǶhr d/.I4_md 0K6) x[gUu=bJe*,-\ÿ q(J?.½liSPI)&'s qՏ X'idV<:qha.rk֜oj m ):-<N^G*޳Ճk c((j L_ZJ ܯsd*σqL+$c=)@QA>o1T:]涥6Nqs թۉǶ6!ďvT=N!kq`*! Z2`I:qiN61nJ0o2 8RlL!nuM27y, io SêەSw%n^"2MyǷ 4Zjk 9C:zUE9R&k;^Wjv-\zJ"h)ڭRiIL&)dZb-^44P0Et {(ILS^ H4Bsu(" Wk@W+Z[`WZ\@ZniD#8KR@I[] &5AWRb pQPkr^PkW9^WW)qHr)DW)) rYOidF,'Us*:/f1S2Ԛs *̯x=j8q9UUfRnem,c\@{bpN>pbG' d kIU-).rOL3WZ}w&(S;1(@+R=Q*J)"A2ݎM". ]Z$ъKYf>Uҭ1 UJn ʍ}*0BV0W<"SۛD xDօq=:D$@iVM$J8qdrDéeAĥA)po@|UVI* 4+f|$3*•jjL˷1Z*qv( ptJ5%!&J5@\RrƼGM$Rp@%BiUتR)04i&E$Sbi Hx Ez8hI#JkNn8BVu Tơ7t@/z\q%ϓ5LY/C E[!I W4F55T.*vCq<1`$ Y#SEyIkP%*H"Uc 㤭,5W>vvV+R\!k'$T>gD 4&W&XuJ $gDtY y7}@F%lJã]8ʤNN;QBlb+6p).:aj$i:5 OVJ-iV#0 Hܾ)T*T):Yr]P+W+i QjF$^b?Ѳb2`(@̣гi#i~E2m{TFS*ec+=jcZ`0Źa֭-l0>L))&$IbKGh~`{0hΛU::Vsԋ甬M'W4&>^aWH| -61vji;1O|IY¢ Ka2@qs'ŒE;*U7°fzTJiiLSLM +^ WkLI"I4 b"j%4ӥ)9O r&R) A.(Ml7 6gUaWDYOEIF)qeq|RrZ֚C#8$w$:,{`SdSL+J xZ% AĶP3yvL^)2w߶*Mkh %nNb[9VRi8LJ eC!A,J8+j}bq +P:O#CQ~Z2>8o&aFp\GY8-C6[J{ϸl<*v3(=;uZz(dS*>+r\v^BO(rĨR]`aX[+8 @"*͈<9oi; WF*k&>s+=Z E )YvAߘz^Upk^+LG-5kƸ.itR*)h I^&9+] .&Egب,V[ P ZxԥmP1`-r" ,&0i ;|);N;d(uq]vP3P. ^ۀAynwIVG7d1?95/,*d%A)i2, RRCayE3wWdpzux!84yEmzi_q򊈲F M[@T*$KC%KJVT9oIy涒`Zuy,ۊN'n)JA\\I"xO]u O9Jc}޺ kus@6ZV(ȫvƧd :隦$:U`lJ=K m*$qUL5\ZMv)`Z3)H Ѐn) &iJw׎ܱD LMr zk֯W&(ӰWW̰. L!Hƶ19]H'<рřKEt5ײT͸I#).I@BmH] "W_brD-\u%{4$eP YJBP)":jC'RKh, -5ϩVA<iL;%f G›R՛2r)ZK|s:$M$iU:S;g!GIVSZ$Ik+8L )1 JPn7F!M0_%6I(:qH!Z>,1eE9R',VTj+*yp!J`v^I=^Mv=^WkbTR ҈i͂J")ItHiJ'aɥR$9 &+R1$kC6ˋF@#Ly*j!-YZD$N4 ^`]sI:%6 HNtRf)%H@ 1}"-O)mpo!7LjOMy"&U%#|JBS ո8PƆNڜVFViN6?m'Ϸqp}&I9}!|MQc'BòjBG?+-HIPmA^QwV"XvԄ7aER! WJFBR0sJVDgQ]í-8pKD·"pHm1(nGu)t 0w}IUhyA4JUؤ7E7o)P:bK,ŘJFTH, Zٍ6 jVPA64i͕Rbsi6'z=ZBp"2ߒ-e×N(XS[YejoT@QEmtJ@[63XWB9^ =5I